Тест на беременность эвик: Аптека Ригла – забронировать лекарства в аптеке и забрать самовывозом по низкой цене в Москва г.


Тесты на беременность Evitest — «Почему тест не сразу показывает беременность и когда его нужно применять, чтобы не тратить деньги на ветер»

Всем доброго времени суток.

Сегодня хочу рассказать про тест на беременность Evitest.

Когда пришла в аптеку, то не имела особого представления чем различаются тесты между собой и взяла именно этот, потому что там было 2 теста внутри.


Именно 2 теста и использовала.



Почему именно два теста!?


Мой цикл составляет 28 дней, последняя менструация началась первого числа месяца. Волшебство без предохранения было 14 и 16 числа, т.е. в момент овуляции. Но как то внутри ничего не ощущалось и 18 числа я побежала в аптеку и вернулась с Evitest.


Тест делать легко. Предпочтительнее делать это утром, когда вы первый раз пойдёте в туалет пописать.


Первый тест

Я взяла одноразовый пластиковый стакан, один тест и отправилась в туалетную комнату.


Чтобы использовать тест:

  1. Надо пописать в ёмкость (у меня одноразовый пластиковый стаканчик).
  2. В жидкость опустить полоску Evitest на 3 секунды обозначенной на тесте стороной.
  3. Вытащить и положить на чистую поверхность. Я положила на упаковку самого теста.
  4. И начала отсчитывать минуту.


Каким же было мое разочарование, когда я увидела отрицательный результат.


Ну ладно, подумала я, значит в следующем месяце….


Второй тест

Следующие месячные должны были начаться 28-29 числа. Как всегда дней за 5 до начала у меня стал тянуть низ живота и налилась грудь.


Но 28, 29 и даже 30 ничего не пришло. Именно тогда мне понадобился второй тест.


Использовала я его также как и первый и …. он показала заветную вторую полосочку))))


Уже позже я изучила принцип действия этих тестов и вообще физиологическую реакцию организма.


Помимо заветного дня овуляции и соответственно оплодотворения яйцеклетки, должно пройти несколько дней, чтобы яйцеклетка приклеилась к стенке матки, а уже после этого пойдут изменения в организме, которые сможет показать тест на беременность. На весь этот процесс уходит 7-10 дней. Поэтому отсчитывайте нужное количество дней и не тратьте тесты (деньги) просто так.


А вам я желаю увидеть на тесте то количество полосок, которые вы хотите.


За месяц до беременности я делала операцию по удалению полипа эндометрия, как все было, читайте здесь.


А ещё за полгода я начала принимать витамины, которые необходимы для того, чтобы забеременеть и вообще для поддержания жизненных процессов в организме.

витамины 1

витамины 2

Витамины 3

Тесты на беременность Evitest — «Неделя задержки-это был жуткий стресс. Я судорожно скупала в аптеке успокоительное и тесты на беременность.

.. С какого дня тест покажет беременность? Насколько надёжно? Бывают ли неправильные результаты? »

Всем привет!

Месяц назад со мной произошла история, после которой я пообещала себе обязательно написать отзыв на Evitest, который меня ни разу не подвёл. Ведь в эту неделю я сама судорожно перечитывала все отзывы на тесты, пытаясь понять, с какого дня после овуляции (незащищенного ПА) тест достоверно подтвердит беременность или её отсутствие.

Немного о себе.

Мне 34 года, и я мама двух мальчишек с разницей в возрасте 8 лет. Тестов на беременность в своей жизни делала много. Наличие беременности всегда подтверждалось двумя полосками, если не беременна — естественно, полоска одна. Средства контрацепции использовала разные — КОК (Джес плюс, логест), презервативы, ППА. Больше детей не планирую (хотя муж очень хочет дочку). Я не уверена в своём здоровье после операции по поводу осложненного аппендицита, последствия которой я ощущаю до сих пор, потом у нас нет пока собственного жилья и крайне неустойчивое финансовое положение.

К тому же младший сын очень плохо спал почти до года, я этот период до сих пор вспоминаю с содроганием и не уверена, что смогу пережить ещё раз такое зомби-состояние…

Почему делала тест.

В феврале я прекратила приём Джес плюс из-за усугубления варикоза и предстоящей операции по этому поводу. Флеболог сказал, что принимать КОК можно только в крайнем случае.

Гинеколог назначила мне Тазалок после отмены Джес, возможно, благодаря ему первые три месяца у меня цикл был как часы — 28-29 дней, я чётко чувствовала овуляцию в середине цикла (по тянущим болям внизу живота и характерным выделениям). Поэтому на четвёртый месяц я расслабилась и на 24 день цикла произошёл незащищённый ПА (мы себе иногда такое позволяем, при 28-дневном цикле шанс забеременеть крайне мал. Но об этом чуть позже).

Проходит примерно неделя, месячных нет. Задержка несколько дней. При этом налилась и болит грудь, немного ноет внизу живота. Блин, ну почему у ПМС и беременности одинаковые симптомы?

В панике покупаю сразу два теста — ВВ-тест и Эвитест, делаю оба одновременно.

По мере намокания тестовой зоны в ВВ-тесте там, где должна быть вторая «беременная» полоска, расползается розовое пятно… Беременна?! .. Мне аж поплохело, в глазах потемнело… На ватных ногах выхожу из ванной и иду прилечь с обоими тестами… Мысленно прикидываю, когда буду уходить в декрет и куда поставить кроватку. Через пару минут прихожу в себя и решаю взглянуть ещё раз на тесты. На ВВ так и осталось размытое пятно, на Эвитесте — чёткая одна полоска. Да что ж такое? Есть беременность или нет? Кстати, очень жалею сейчас, что не сфоткала эти тесты, но было честно, не до этого…

То ли ВВ-тест бракованный, то ли неправильное хранение…

В общем… Вечером того же дня делаю ещё один Эвитест- отрицательный. Успокаиваюсь и ещё дня три спокойно жду месячных. А их нет.

Понимаю, что у меня мог быть длинный цикл — у меня так бывает — 35-40 дней, а в таком случае овуляция происходит ПОЗЖЕ и шанс забеременеть на 24 день цикла ВОЗРАСТАЕТ. Паника, руки дрожат, глотаю успокоительное и делаю ещё один тест. Чёткая одна полоска.

Тем не менее, я не успокаиваюсь, перечитываю отзывы. У меня редко, но бывают значительные задержки, и если этот цикл именно такой, то я могла забеременеть. Стараюсь понять, на какой день после ПА тест ДОСТОВЕРНО покажет беременность. И вот что могу сказать по этому поводу.

Может ли тест показать беременность ДО задержки?

Да. Вот какую таблицу я нашла:

Чувствительность Эвитеста 20 единиц, то есть такую концентрацию ХГЧ он достоверно определит. То есть, если верить таблице, слабая полоска может быть уже на 9 и даже 8 ДПО (день после овуляции), а на 12-13 ДПО результат будет абсолютно точным.

Важные моменты:

  • Считаются именно дни после овуляции, а не после ПА, так как зачатие может произойти на день-два позже ПА.
  • Нужно понимать, когда у вас овуляция. При 28-дневном цикле это 13-15 день от начала месячных. Если цикл длиннее или короче, то, скорее всего, овуляция происходит за 14 дней ДО месячных (а не после). То есть если ваш цикл 35 дней, то овуляция (скорее всего) на 21-й.
  • Многие девушки понимают, когда у них овуляция — по характерным ощущениям внизу живота и/или выделениям прозрачной слизи.
  • Рекомендую отмечать цикл в специальном приложении, тогда будет значительно проще.

На тестах с чувствительностью 10 ед (тот же ВВ) пишут, что они определяют беременность с 7 дня после зачатия. Технически (судя по таблице) это возможно. Стандартная чувствительность тестов — 25 ед, у Эвитеста — 20. Насколько это важно, напишу чуть позже.

Если тест отрицательный, а месячных все нет, повторите тест ЧЕРЕЗ ДЕНЬ утром.

Чем закончилась моя эта история.

Через день после описанных событий я сделала ещё один тест утром — чётко отрицательный.

На следующий день (35 день цикла!) начались месячные. Выдохнула. Просто задержка. Я поблагодарила Бога, что все обошлось. Беременности я не хотела. Сделала для себя выводы.

Планирую поставить гормональную спираль, пока этот вопрос затягивается из-за определённых проблем со здоровьем. ПА от «окна зачатия» разделял буквально один день… Свой цикл я отслеживаю в приложении:

Важные моменты.

Естественно, когда я была беременна (два раза) тесты были положительными, расскажу как это было и какие выводы. Тесты с двумя полосками я бережно хранила, но в силу обстоятельств они потерялись, и показать не могу, к сожалению.

Итак, мой опыт. Да, кстати, оба раза при беременности я тесты делала уже ПОСЛЕ задержки, поэтому сказать по опыту, на какой день после зачатия появляется вторая полоска, не могу. Но тем не менее:

  • По опыту — в инструкции пишут не оценивать результат раньше 2-3 минут и после 5 (иногда 10) минут. Прислушайтесь. Один раз думала, что тест отрицательный, и спокойно понесла выбрасывать. Случайно взглянула, уже перед тем, как бросить в урну- а там появилась вторая полоска (так я узнала о второй беременности). А один раз минут через 30 на отрицательном тесте вроде как проявился намек на вторую полоску. На самом деле беременности не было. Так что оценивайте результаты в рекомендуемый временной промежуток!
  • Во время моих беременностей (а в первую Б я переделала, наверное, около 30 тестов 😂) ВСЕГДА, в любое время суток, на любых тестах — от копеечных до весьма нескромных по цене- были явные две полоски. На Эвитесте — результат один из самых чётких! Вторая чаще была бледнее, но она БЫЛА!
  • Разницы «показаний» у тестов с разной чувствительностью не заметила. Повторюсь, по моему опыту, именно Эвитест даёт один из самых точных результатов.
  • С каждым днем беременности вторая полоска становится все чётче и ярче.
  • В рекомендуемое время оценивания результата: ЧЁТКАЯ одна полоска — беременности нет. Если проявляется хоть и очень слабая, но вторая полоска — есть беременность.

Немного о календарном методе предохранения.

Я могу сказать, что все 8 лет между двумя беременностями мы предохранялись именно так, и беременности не случилось. Но для этого нужно иметь стабильный цикл и «быть в теме», то есть понимать, что такое овуляция и когда она происходит, в какие дни зачатие возможно. Рекомендую, кстати, скачать любое приложение для отслеживания цикла, так будет проще разобраться.

На самом деле, довольно забавно. Читаешь статьи типа «как не забеременеть» — там пишут, что забеременеть можно абсолютно в любой день цикла) В статьях, где, наоборот, даются рекомендации, как забеременеть — указано, что для этого дела у вас есть всего 24 часа в месяц непосредственно после выхода яйцеклетки.

Знаю ещё, что некоторые фонды раздавали африканским женщинам специальные бусы. Там было 28 бусин, начиная с первого дня месячных надо каждый день сдвигать бусину. Фертильные дни в середине цикла обозначены бусинами другого цвета, в эти дни женщинам предлагалось избегать сексуальных контактов во избежание беременности. Вот такая контрацепция) За неимением/недоступностью других вариантов вполне себе способ, хоть и ненадёжный.

На самом деле, если у вас серьёзные причины избегать беременности, рекомендую предохраняться гормональными средствами или ВМС. Любые побочные эффекты от них куда мягче аборта.

Буду рада, если кому-то мой отзыв будет полезен. Все мы люди, у всех в жизни бывают волнительные моменты. Всем желаю здоровья и того количества полосок на тесте, которое вы хотите.

А по теме — Эвитест качественный и достоверный тест на беременность, который ни разу не подвёл.

Мой отзыв на лапароскопическую операцию по поводу кисты малого таза — совсем не страшно и не сравнимо с полостной!

Тест на беременность эвитест перфект струйный


Всегда беру только евитест, ни разу не обманул, что при первой, что при второй, что при третьей беременности. Также брала ева тест стоит около 15 р показывает очень очень тусклые красные полосочки, а евитест показал яркие полоски и гинеколог подтвердила только по этому тесту беременность


Купила самый дорогой эви последнего поколения как мне сказали,не показал не одной полоски……


А мне попались два бракованных Эвитеста. На одном вообще не было полосок, даже контрольной, а на втором реагент растекся по всей поверхности. Может, конечно, это партия была такая, но больше рисковать деньгами не хочется.


Цена явно завышена, ничего такого особенного в Eviteste не нашла. Есть масса тестов дешевле с тем же качеством. Так зачем переплачивать? Тем более отзывы о Evitest часто попадаются плохие.


Прежде брала Evites, пока они не начали «чудить»: то на месте «беременной» полоски пятно расплывается, то вообще ни одной полоски. Так что от Evites отказалась в пользу более качественных тестов.


Присоединяюсь к Вашему отрицательному отзыву об Evitest. Я тоже перешла на Frautest. Стоит подешевле, а бракованного ни разу не попалось.


Понимаю Вас. А у меня тоже опыт с ним отрицательный. Мне Evitest показал две полоски. Радовалась, как ненормальная. Хорошо муж предложил купить еще парочку разных тестов — перепроверить, для большей уверенности. Все другие тесты показывали четкую одну полоску. Но я то уже настроилась, что все хорошо, я наконец беремнна. Пошла к врачу записалась, кровь сдала — ничего нет. Вот вам и две полоски. Обманул меня Evitest.


Тест evitest обманул меня — показал 1 полоску, когда беременность уже была! Из-за этого я чуть не лишилась ребенка, потому что врач сказал прекращать Дюфастон, елс тест покажет 1 полоску. Но какое-то чувство меня остановило, и я поискала отзывы по этому evitest-у. И узнала, что он может врать! Купла другие тесты, и они показали 2 полоски. Так что будьте очень осторожны, не доверяйте этому тесту на все 100 процентов! Есть тесты гораздо более надежные.


Бренд EVITEST (Эвитест) — линейка высокочувствительных тестов

Evitest Plus — двойной тест для подтверждения результата. Экспресс-тест/тест-полоска на определение беременности.

Evitest Plus — комплектуется двумя тест-полосками. Первая предназначена для определения основного результата, а вторая — для подтверждения первого через 48 часов, так как при беременности ХГЧ в моче увеличивается вдвое на каждые вторые сутки.

EVITEST — Высокая чувствительность 20mME/мл позволяет диагностировать беременность уже в 1 день задержки менструального цикла или даже за 1-2 дня до ее предполагаемого начала.

Принципы работы тестов Evitest

Все серии приборов Эвитест основаны на том же принципе действия, что и все остальные системы по установлению беременности.

Анализаторы имеют в своем составе реактивы, которые чувствительны к гормону ХГЧ, который содержится в моче женщины.

На первых стадиях образование гормона провоцируется формированием хориона (оболочки зародыша), а далее, в период вынашивания плода, — плацентой.

Выброс ХГЧ в кровь и мочу происходит уже на пятый или шестой день зачатия, но его уровень настолько низкий, что еще не улавливается реактивом.

ВНИМАНИЕ!!! Самую точную информацию тесты смогут показать с первых дней задержки менструации либо через 10 дней со дня овуляции.

Главными отличиями между разными видами тестов Evitest является способ забора мочи и комплектность составляющих самого прибора, что и обуславливает наличие тех или иных достоинств и недостатков.

Evitest Plus состоит из 2-х тестовых полосок, на поверхность которых нанесен специальный реактив. Чтобы провести анализ, нужно собрать мочу в предварительно подготовленный чистый и сухой контейнер и опустить в него полоску, извлеченную из индивидуальной упаковки.

Evitest Plus комплектуется двумя тестовыми полосками, которые находятся в разных индивидуальных упаковках. С помощью первой тест-полоски устанавливается основной результат, а с помощью второй — он подтверждается.

Достоинства: простота использования

Недостатки: сбор мочи в отдельный контейнер.


1. Чувствительность 20мМЕ/мл;

2. Точность 99% при определении беременности с первого дня задержки*

3. Производитель: Хельм медикал Гмбх (Helm Medical Gmbh). Гамбург, Германия

*Согласно инструкции по применению экспресс-тестов на беременность Evitest

Сериал Тест на беременность смотреть онлайн

С лежащей под капельницей пациенткой Нефедовой беседует акушер-гинеколог Наталья Бахметьева: динамика ухудшилась, давайте обсудим варианты, я вызвала уролога. Нефедова: если он удалит мне вторую почку, в этом будет какой-то смысл. Бахметьева: ждать рискованно, я вам предлагаю родоразрешение на 31 неделе. Нефедова отказывается: Колмогоров сказал, что еще 3-4 недели я смогу продержаться, я хочу родить здорового ребенка. Я знала, на что шла – единственная почка, хронический пиелонефрит. Я все решила – хочу доносить. А Колмогоров вел вас с самого начала беременности? Да, я выбирала лучшего врача. Когда он направлял меня к вам, то сказал, что я смогу решать сама, если будут варианты. А они есть.

Бахметьева безуспешно пытается дозвониться до Колмогорова. Бахметьева подходит к главврачу клиники Илье Яковлевичу, говорит, что Нефедову нужно срочно оперировать. А что Колмогоров? Недоступен. Главврач говорит, что при такой срочности Бахметьева вместо того, чтобы дергать его, могла бы взять инициативу в свои руки. В этот момент Бахметьеву вызывают к Нефедовой. У пациентки зафиксирована остановка дыхания. Реаниматолог делает ей интубацию и непрямой массаж сердца. Нефедову доставляют в операционную. Но, несмотря на все усилия Бахметьевой и ее коллег, пациентка умирает на операционном столе. Ребенка удается спасти.

Бахметьева подъезжает к зданию РАМН. Она оставляет Колмогорову сообщение на автоответчике: спустись, я у тебя внизу. Но потом она видит, что Колмогоров выходит из здания. Бахметьева ему сообщает: если вам интересно, Юрий Алексеевич, то Нефедова Надежда Григорьевна умерла во время операции. Ей Колмогоров сказал, что в 46 лет с одной почкой можно на 40-й неделе родить богатыря и гения. Юра, я сто раз тебе звонила… Колмогоров заявляет: хватит вести себя, как трепетная студентка, тебе давно пора принимать собственные решения, пора уже повзрослеть. Разбирайся! Оставив Наталью, Колмогоров направляется к своей жене, которая встречает его возле машины. Она спрашивает мужа: кто это? Студентка моя. Колмогоров целует жену, они усаживаются в автомобиль и уезжают.

Бахметьева подает заявление об увольнении по собственному желанию. Илья Яковлевич: ты не виновата, не казни себя. Потеря пациента на операционном столе – это всегда трагедия, но такое случается. Бахметьева: не надо меня утешать, просто подпишите заявление, я не передумаю. Илья Яковлевич: но ведь ты понимаешь, что без благословления Колмогорова тебя теперь в Москве ни к одной лавке не подпустят. Бахметьева: к счастью, лавки есть не только в Москве. Подписав заявление, Илья Яковлевич сообщает: пару недель назад мне звонил старый знакомый, главврач клиники одного северного города, он искал заведующую обсервации – молодую, перспективную.

Поздно вечером Бахметьева грузит вещи в багажник своей машины. Подъезжает Колмогоров: Наташа, что происходит? Почему нужно все сразу бросать – клинику, диссертацию? Сбегать среди ночи, на мои звонки не отвечать – что за детский сад? Бахметьева: разве ты не понимаешь? Человек умер. Колмогоров: да, пациенты иногда умирают. И что? Проанализировали, погрустили – едем дальше. Бахметьева: вот я и еду. Колмогоров: кому и что ты доказываешь? Что сможешь со всем справиться без меня? Ты со мной десять лет прожила. Юра, прожить – это когда под одной крышей. Так тебе простого обывательского счастья захотелось? Я слишком мало о нем знаю, чтобы хотеть. Зато точно знаю, чего больше не хочу. Думать, что у тебя есть мужчина, когда его нет. Уговаривать себя, что круглосуточно работать и встречаться с тобой раз в неделю – это нормально. Спасибо, что напомнил, сколько мне лет. Я еду взрослеть и узнавать, чего хочу я.

Бахметьева приезжает в Санкт-Петербург.

Акушер-гинеколог Алла Валерьевна Кашина отсыпается в рабочем кабинете после празднования накануне с коллегами своего юбилея. Кашиной исполнилось 50 лет. Ее будит телефонный звонок: в клинику привезли очередную пациентку. Кашина приводит себя в порядок и отправляется в приемное отделение. Она интересуется: что у нас здесь? Воды отошли сорок часов назад. Кашина осматривает пациентку, командует: каталку! В оперблок ее, быстро! В палате остается муж роженицы, он облачен в наряд кришнаита, читает мантры.

Бахметьева подъезжает к зданию клиники, где теперь будет работать. Охранник отказывается пускать ее на парковку. Он ссылается на инструкцию: вашей машины нет в списке, я вас не знаю, о вас меня никто не предупреждал, пропуска у вас тоже нет. Бахметьева говорит, что может позвонить главврачу. Охранник заявляет, что у него свое начальство, которому он подчиняется. Бахметьева оставляет в залог свой паспорт, чтобы ее все-таки пропустили.

Акушерка Евгения Ефимовна Мишина, которую коллеги панибратски называют Мишей, с помощью деревянной трубки пытается услышать сердцебиение плода пациентки-кришнаитки. Молодой акушер-гинеколог интересуется: ну что там, Миша? Если я ухом не слышу, значит, его нет. В оперблок заходит Кашина, сообщает: главврач недоступен. Мишина обращается к Кашиной: плод мертв, надо делать плодоразрущающую. Оставь ты ей матку, дуре, ведь первый же ребенок, не надо, чтоб последний был. Раздраженная Кашина одергивает акушерку: Евгения Ефимовна, занимайтесь своим делом. Обиженная Мишина отходит. Появляется анестезиолог Александр Анатольевич Донцов: ну и что тут у нас? Кашина: надвлагалищная ампутация, из-за длительного безводного. Донцов вздыхает: значит, судьба у нее такая – бездетной быть. Кашина: хотела бы детей, не рожала бы дома.

В коридоре интерн Павел Саморядов заполняет историю болезни вновь поступившей пациентки. Рядом стоит Миша, она ворчит: зачем же сразу на стол и матку кромсать? Вот раньше вытаскивали мертвый плод через определенное место, а матку на месте оставляли. Подходит Бахметьева, здоровается, заглядывает в историю болезни, приходит в ужас и бежит в операционную. Мишина: что это сейчас было? Павел: сам не понял.

Кашина заносит скальпель над животом пациентки. В операционную врывается Бахметьева, она сбрасывает на пол приготовленные для операции хирургические инструменты. Кашина возмущается: почему посторонние в оперблоке? Вызовите охрану! Бахметьева представляется, говорит, что с сегодняшнего дня она – заведующая отделением обсервации. Потом она командует: пациентку в родзал, быстро!

Мишина помогает Бахметьевой извлечь мертвый плод. Павел во время этой процедуры падает в обморок. Донцов приводит интерна в чувства и выставляет в коридор.

После успешно проведенной операции Бахметьева говорит Павлу, чтобы тот оставил свою чувствительность для свиданий, в операционной – это непозволительная роскошь. Бахметьеву вызывает главврач. Когда она уходит, Павел спрашивает Донцова: кто был прав – Бахметьева или Кашина? Тот говорит: Кашина делала, что полагается, а Бахметьева замахнулась на большее. Так вы за Бахметьеву? Нет, я – за своих. Мы с Кашиной вместе полдивизии детей нарожали, а врачи с синдромом бога мне никогда не нравились.

Кашина выговаривает главврачу клиники Олегу Евгеньевичу Саморядову (отцу Паши): ну и подарочек ты мне к юбилею преподнес. Не мог хотя бы предупредить заранее? Саморядов: Бахметьева действовала смело и профессионально, и она сохранила матку, которую ты хотела на куски порезать, чтобы только не рисковать. Ага, а сейчас поднимется температура, и придется матку все равно удалять, но только уже септическую. Накаркаешь ведь! Иди работай и не мешай ей. Я буду следить.

В кабинет входит Бахметьева. Кашина, поджав губы, удаляется. Саморядов поздравляет новую заведующую обсервацией с боевым вступлением в должность. Только учтите на будущее: такие решения принимаются консилиумом. Бахметьева: который надо еще собрать, а риск инфекционных осложнений повышается. Саморядов: я не сомневаюсь, что вы хороший врач, но какой вы будете заведующей – еще неизвестно. Нужно уметь строить отношения с подчиненными.

После обхода Бахметьева отчитывает Павла. Вы зачем пациентке про отслоение плаценты ляпнули? Если в следующий раз вам что-нибудь померещится, потерпите до коридора, пожалейте пациентку. Вы ее историю болезни читали? У нее восемь выкидышей было! Она еще ни разу до 30-й недели не доходила. Потом Бахметьева переключается на Сеченова: я вас просила сделать УЗИ, где оно? Сеченов молчит. Бахметьева уходит. Павел: она вообще умеет нормально разговаривать? Сеченов: меня другое беспокоит. Я ей карты принес за полчаса до обхода. Как она успела изучить все про 12 пациентов? Чувствую я, Паша, кончилась наша с тобой вольная жизнь. Кашину еще будем потом вспоминать как доброго царя.

В здание клиники входит специалист по искусственному оплодотворению Руслан Базанов. Старшая медсестра Дина Рафаиловна делится с ним последними сплетнями о новой заведующей обсервацией. Узнав ее фамилию, Базанов роняет из рук стаканчик с кофе.

К Базанову на прием приходит пациентка, которая уже 15 лет пытается забеременеть. Ей 25 раз делали ЭКО, но безрезультатно. Базанов уверяет, что шансы на успех все-таки есть. Он не видит причин отказывать женщине, которая так хочет стать матерью.

В обеденный перерыв Бахметьева отдыхает на скамейке во дворе клиники. К ней подходит кришнаит: почему вы не спасли моего ребенка? Потому что вы свою жену мариновали дома два дня. Кришнаит плачет: так вы тоже считаете, что дома рожают одни мракобесы? Но ведь нельзя отрывать ребенка от матери, когда он родился, пуповину нельзя резать, а плаценту надо похоронить. Мы так хотели детей, Моя жена два года не могла забеременеть. Потом мы в Индию поехали, и произошло чудо. Почему вы не спасли ребенка?

Во двор выходит врач-неонатолог Андрей Лазарев. Он обращается к кришнаиту: тебя как зовут? Андрей. Послушай, тезка, твоя женщина любимая жива? Да. Это главное. Рожать еще сможет – тоже неплохо. Давай сейчас пойдем к ней, ты скажешь, что любишь ее. Лазарев уводит кришнаита.

Бахметьева видит, как из подъехавшей к клинике машины выходит Базанов. Она узнает однокашника, подкрадывается к нему сзади, закрывает ладонями глаза: Русланчик-Базанчик, солнечный мальчик. Бахметьева! Наталья повисает у Руслана на шее. Тот говорит: ты совсем не изменилась. А ты вырос и стал еще красивее, тебе не стыдно? Бахметьева спрашивает: где здесь буфет? Я еды сутки не видела. Базанов: буфет – это не еда. А ты по-прежнему такой же сноб. Из здания клиники выходит длинноногая шатенка в медицинском халате, здоровается с Базановым, проходит мимо. Бахметьева: это что, сестра Николь Кидман? Базанов: врет, что завлабораторией. Это Ольга Ольшанская, большая умница. Влюблена? Но не в меня. Базанчик, ну неужели может быть кто-то, кто влюблен не в тебя? Ты же вроде голодная была, пойдем есть.

Лазарев приходит в лабораторию, просит Ольшанскую сделать один анализ. Ольшанская расспрашивает Лазарева про Бахметьеву. Тот говорит, что видел ее мельком, но уже по первому случаю ясно – максималистка, с такими трудно. Ольшанская: в пятницу встречаемся? Лазарев: в пятницу у меня дети. В субботу? Ольшанская: ну не знаю. У меня спортклуб, массаж, потом встреча с другом детства. Если ты, конечно, втиснешься… Лазарев целует Ольшанскую: я компактный.

В столовой Базанов и Бахметьева расспрашивают друг друга, что произошло за семь лет, в течение которых они не виделись. На вопросы о личной жизни и причинах отъезда из Москвы Бахметьева отвечает уклончиво. У нее звонит телефон. Произошла авария, восемь машин. В числе пострадавших везут беременную женщину.

У приемного отделения Павел и Сеченов ждут прибытия пострадавшей в аварии пациентки. Подходит семейная пара. Беременная женщина говорит, что пятилетняя дочь пнула ей вчера вечером в живот: болит очень сильно. Сеченов поручает Павлу сделать УЗИ. Идущая навстречу Кашина говорит, чтобы Павел начинал осмотр, она подойдет позже.

Привозят пациентку после аварии, она на 40-й неделе беременности, у нее травма бедра и кровотечение. Кашина считает, что отслоилась плацента. Бахметьева дает ей распоряжение: везите в оперблок, сначала кесарево, потом – бедро, зовите травматолога. К Кашиной подходит Павел: а что делать с женщиной, которую дочь в живот пнула? Ой, совсем забыла. Что УЗИ? Сделал, ничего не видно, но, похоже, что-то не так. Она на боль жалуется. Пациенткой решает заняться Бахметьева. При осмотре женщина морщится от резкой боли. Это у вас шрам от кесарева? Да. А другие операции были? Миому вырезали.

Бахметьева и Павел подвозят пациентку к операционной. Возле нее стоит еще одна каталка с женщиной после аварии. Бахметьева спрашивает Кашину: почему до сих пор не начали? Все анестезиологи сейчас в хирургии, на аварии. Мишина: будут чрез 20 минут, если не врут. Бахметьева: нам срочно нужна операционная, состояние критическое. Кашина: мы не можем делать два кесарева одновременно, у пациентки большая кровопотеря. Бахметьева: ваша может подождать, у нее множество повреждений, но ребенок вне опасности, а здесь мы можем потерять обоих.

Бахметьева считает, что у ее пациентки произошел разрыв матки. Она делает ей кесарево сечение под местной анестезией. В результате остаются в живых и ребенок, и роженица. Мишина восхищена действиями Бахметьевой. Кашина считает, что той просто повезло.

Базанов помогает Бахметьевой найти квартиру в Санкт-Петербурге. По дороге на работу Бахметьева расспрашивает его о своих подчиненных: кого из них мне бояться? Себя, с остальными справишься.

В клинику привозят поп-диву Меридиану (ее настоящее имя Марина).На приеме у Бахметьевой та говорит, что уже на поздних сроках беременности у плода был выявлен синдром Дауна. Муж поп-дивы – олигарх, он ждет нормального наследника. Поэтому Марина скрыла от него диагноз. И теперь она не хочет, чтобы ребенок родился живым. Бахметьева говорит, что ни один врач не согласится убить ребенка с патологией. Марина намерена покинуть клинику, но в дверях она падает в обморок. Бахметьева настаивает на госпитализации ВИП-пациентки, у которой наблюдается предлежание плода.

Базанов пытается убедить пациентку, которой его коллегами из другой клиники была проведена процедура ЭКО, избавиться хотя бы от двух из четырех эмбрионов. Родить здоровую четверню – очень мало шансов. Женщина упрямится.

В клинику доставляют заключенную из СИЗО.Женщина (Анастасия) убила мужа – превышение самообороны, тот ее бил. У нее уже начались схватки. Несмотря на протесты Дины Рафаиловны, Бахметьева дает распоряжение оформить пациентку и выдать сопровождающим ее конвойным халаты.

В конце рабочего дня Саморядов вызывает Бахметьеву и говорит, чтобы та в неординарных ситуациях ставила руководство в известность о своих решениях.

Поздно вечером у Меридианы начинается вагинальное кровотечение. Ее срочно доставляют в операционную.

Бахметьева принимает приглашение Базанова поужинать в ресторане. Тот заказывает шампанское, выражает надежду, что их отношения станут больше, чем дружескими. Бахметьева кокетничает и отшучивается.

Миша видит, что Кашина не может справиться с кровотечением у Меридианы. Она звонит старшей медсестре и требует, чтобы та вызвала Бахметьеву: иначе у нас будет два ВИП-трупа.

Попрощавшись с Базановым, Бахметьева отвечает на звонок Дианы Рафаиловны и мчится в клинику. Она сменяет Кашину и заканчивает начатую той операцию. Ребенок рождается недоношенным. Им занимается Лазарев. Утром он сообщает Меридиане: ваш ребенок жив, мальчик, пришли генетического анализа, у вашего сына синдром Дауна. Спасибо, я в курсе.

Меридиану навещает ее продюсер Владик. Он говорит, что ребенок-даун у звезды может стать поводом для сумасшедшего пиара: все просто обрыдаются. Меридиана заявляет: не пошел бы ты лесом с таким пиаром.

Бахметьева принимает роды у Анастасии. Приходит Павел. Бахметьева чувствует сильный запах перегара от интерна. Она заявляет, что Павел на три дня разжалован в санитары, и прогоняет его.

К Меридиане приходит муж. Узнав о том, что ребенок родился с неизлечимой патологией, олигарх заявляет: мы расстаемся, все, что прописано в контракте, ты получишь. А ребенку? В контракте у нас прописан здоровый ребенок. Олигарх уходит.

У Анастасии рождается здоровый мальчик. Но у заключенных нет возможности воспитывать своих детей.

Меридиана принимает решение отказаться от своего ребенка. Она просит Бахметьеву и Лазарева пригласить к ней юриста.

Базановвыступает на медицинской конференциив институте, где преподавал его покойный отец. Он рассказывает интернам о современных методах ЭКО.После лекции с ним знакомится дипломница Инга Елизарова.

Саморядов говорит Бахметьевой, что обычно детям начальства очень многое прощается. Но она поступила с Павлом правильно: я еще надаюсь, что из него выйдет настоящий врач. Поэтому впредь не прощайте ему ничего подобного.

Ночью Меридиана приходит в отделение неонатологии. Она плачет возле бокса для недоношенных детей, просит у своего сына прощения.

Тесты на беременность Evitest — отзывы

Отрицательный отзыв

Добрый день всем, кто читаем этот отзыв! Помню, как сама читала, изучала множество отзывов о различных тестах на беременность, выбирая лучшие. Как волнительно всё это было…

К своей беременности мы шли очень долго, путь был трудный, через ЭКО, но это другая история. И вот, после очередной подсадки, ожидая длительно тянущиеся 2 недели до официальной сдачи крови на ХГЧ, я начала скупать тесты в ближайших, и не очень, аптеках. Многие девочки хорошо отзывались о тестах Evitest. И конечно они были мною куплены, среди и некоторых других фирм.

Теститься начала я на 6 дпп (день после подсадки), это примерно равнялось бы 11-му дню после овуляции, и начала конечно с Эви. Я не могла поверить своим глазам, я думала никогда не увижу этого — почти сразу появилась вполне различимая вторая полоска!!! И после высыхания теста она никуда не пропала. Ее видно даже спустя уже 5 месяцев.

Но некоторые писали, что Эвики могут и врать, а т.к. у меня с утра в этот день была небольшая мазня, то старалась сильно не радоваться, ожидая следующего дня.

На следующий день я повторяю Evitest, так же на первую утреннюю мочу, а на тесте призрак-призрака, и лишь спустя некоторое время! Что это может значить??? Моим страхам не было предела!

На фото ниже 2 этих теста вместе, верхний — первый

На следующий день не выдерживаю, делаю другой тест, на этот раз

струйный Clearblue, который рисует мне слабенький +, но его видно! Бегу в больницу, сдавать кровь, ну и что, что рано, но ведь тесты что-то уже показывают, значит кровь даст мне конкретный ответ. Результат 20,1. Ответы я так и не получила, потому что в лаборатории, в которой сдавала кровь, результат 5-25 означает сомнительный, требуется пересдача анализа через несколько дней. Как же я справилась со своими страхами?! Вдруг биохимическая, или может внематочная… Чего я только не передумала в своей голове…

После обеда мы с мужем поехали в деревню к его родителям, дорога дальняя, дорога ужасная, потряслась. Под вечер начал побаливать живот. Когда пошла мыться в баню, то заметила кровяной сгусточек. Маленький, но будто с кусочком эндометрия. Девочки, не передать словами, что я испытала. Еле успокоилась, чтобы без слез вернуться в дом. А деревня, нужно сказать, полузаброшена, ни одной аптеки нет, не говоря уже о больнице. Двойная доза поддерживающих лекарств и в кровать. На следующий день муж едет в район, и конечно прошу его купить там тест. Он купил… EVITEST!

Решила дождаться утра, чтобы выполнить тест в соответствии с инструкцией. Страшно было, не передать словами как… В течение дня была небольшая мазня, как раз в этот день должны были начаться КД.

И вот, утро, бегу с тестом в туалет, и…. Эвик чист, кристально, ни полоски, ни призрака, ни прадедушки призрака! ВООБЩЕ НИЧЕГО!!!! Весь день мы с мужем по очереди всматривались в эту пустоту — вдруг хоть что-нибудь появится. Но ни намека не появилось за весь день. Немые слезы. Полное разочарование в жизни… Я 9 лет ждала этих заветных полосочек!!! Я действительно чуть не поседела в этот день.

Через день собирались возвращаться домой, но кровянистые выделения утром были сильнее, побоялась в дорогу с этой тряской, решили остаться еще на денек. Хорошо с собой были припасены все лекарства, и на всякий случай выпила кровоостанавливающие, и снова двойная поддержка. Весь день провела в кровати.

Утром на следующий день все же поехали домой. А на следующий день, это 14 дпп, иду сдавать кровь. Никаких тестов решила не делать. После обеда к врачу, которая вела мою программу переноса, результат крови уже у нее.

Девочки, я проклинала тогда этот evitest, результат был 129,9!!!! Я беременна!!!!!! Я плакала прям у врача в кабинете, это невозможно было сдержать в себе.

Я больше никогда не буду брать тесты этой фирмы. Нервы мои мне дороже. Если нет возможности сдать кровь — возьмите другой тест.

Через день я конечно сделала еще тестик, в этот раз взяла Clearblue электронный. Он подтвердил 2-3 недели беременности. На этом моя эпопея с тестами закончилась, дальше мы следили за ростом уже по УЗИ!

Всем ожидающим и уже дождавшимся своего маленького и такого важного СЧАСТЬЯ желаю благополучия, успехов и крепкого здоровья!

Отзыв о Тесты на беременность Evitest от Варвара | Варвара

Я уже писала отзыв на . А сейчас хочу написать о своем любимчике — Эвитесте.

Много тестов….. Нет, не так… МНОООГО тестов на беременность прошло через мои руки. Всяких разных. От самых простых и дешёвых до цифровых. Но эвитест остаётся неизменным лидеров среди них.

Если я сомневаюсь в правдивости того или иного теста, я иду за Эви. Если мне нужен точный ответ на вопрос «точно беременна?», я иду за Эви. Вообще в любой непонятной ситуации я иду за Эви 😁

И уж если он показывает мне 2 полоски, пусть даже одну бледную (но явную), то я уверена на 99%, что это беременность. Хотя и буду перепроверять в любом случае.

Точно так же и с отрицательным результатом. Если Эвитест показывает одну полоску, то либо нет беременности, либо слишком рано и нужно подождать ещё пару дней, чтобы повторить тест.


Тестирование лучше проводить на утреннюю мочу. Если задержка уже большая, то это уже не обязательно. Утром нужно делать на маленьком сроке.

Рекомендуется делать тест в 1 день задержки, но очень часто Эвитест показывает беременность до задержки.

Если вы точно знаете, когда была овуляция, выждите 12 дней после неё и делайте первый тест. Многие уже на таком сроке видят на тесте 2 полоски (а некоторые и на 10 день после овуляции). В любом случае, через пару дней тест лучше повторить.

Ещё видела, как девушки делали тесты на овуляцию при наступившей беременности. И они выдавали им четкие 2 полоски (одинаковые по яркости). Интересный способ, надо будет попробовать 🙂


Чаще всего я покупала двойные эвитесты. А вчера взяла одинарный.

Изменился дизайн упаковки. Очень надеюсь, что качество самого теста осталось прежним.

Содержимое коробочки неизменно. Никаких сюрпризов. Тест и инструкция.

Если лень читать инструкцию, на обратной стороне коробочки краткие рекомендации по использованию.

Ниже в отзыве я покажу старый и новый эвитесты. Различия не только в дизайне.

Сам тестик находится вот в такой упаковочке.


Мне кажется, производителям тестов пора перестать ради одной мааааленькой полосочки тратить столько на упаковку. «Берегите природу!» хочется сказать. Заодно и цену на сам тест можно уменьшить. Но это так, лирическое отступление 🙄


Теперь о себе. Купила этот тест, потому что месячных нет уже 2 месяца. И хотя для меня это не ново (цикл нерегулярный был всегда), я делаю периодически тесты на всякий случай.

У нас есть дочь, которой в октябре будет 3 года. Всё чаще посещают мысли о втором ребенке, но пока страшно. Боимся, что не справимся. Поэтому именно планированием не занимаемся. Но в то же время стали чаще практиковать ППА.

Этот метод хоть и не надёжный, но не подводил нас ни разу за 10 лет. И если вдруг будет осечка, то, в любом случае, ребенка мы будем сохранять. Это даже не обсуждается.

Видимо, так психологически нам проще. Вроде как не мы решили, а случайно вышло 😄 Жертвы обстоятельств, блин 🙈


За день до этого теста, я сделала другой, не Эви. Кстати, он внешне практически копия Эвитеста. Называется Berotest. Только чувствительность на нем 25 мМЕ/мл. А у Эви 20.

Вот они. Угадайте, где здесь Эвитест? 😁

Эвитест и Беротест

Конечно, на Эви немного чётче полоска. Но всё равно, за цену почти в 4 раза ниже можно простить этот недостаток. Хотелось бы, конечно, сравнить эти тесты, когда они будут положительными. Но этот Беротест у меня был последний. Может ещё удастся его купить.


Когда намочила Эвитест, то через несколько минут я увидела очень слабую, но различимую вторую полоску. А т.к. на вчерашнем тесте я в фоторедакторе подрисовала вторую полоску и мужу фотку отправила (ради прикола), то у меня сразу промелькнула мысль в голове «Дошутилась» 😄

Это знаете, как долго планирующие девушки дорисовывают ручкой или маркером вторую полоску прям на тесте. Так сказать, для визуализации 🙈

Тест подсох и вторую полоску уже практически не видно. Возможно, это место с реагентом просто очень четко выделялось. Окрашивания в цвет реагента (даже бледного) не произошло. Поэтому тест считается отрицательным. Но я всё равно завтра сделаю ещё один для уверенности.


Специально пишу сразу. Но опубликую отзыв только после того, как сделаю повторно ещё 1 или 2 теста. Чтобы быть уверенной.


Итак, ровно 90 дней длился мой цикл. Самый длинный в моей жизни 🙊

Ох, сколько же я тестов замочила за это время 😬 Разных тестов. О каждом расскажу в отдельных отзывах.

Забегая вперёд, скажу, что были среди них вруны, которые показывали мне 2 полоски, которые видела не только я, но и муж. А в итоге беременности не было.

Биохимическую беременность не допускаю, т.к. делала одновременно по 2-3 теста и другие были кристально чистые.


Брала я Эвитест ещё раз. И мне попалась коробочка со старым дизайном.

Вот несколько фото для сравнения:

Мне нравится новый дизайн больше, чем старый. Но это, конечно, не главное.

Если сравнить производителя, то название фирмы отличается. Тесты по-прежнему производят в Гамбурге. Но вот название фирмы-производителя и адрес разные.

Прежний производитель: Helm Medical GmbH

Новый производитель: Sanavita Pharmaceuticals GmbH

Эвитест инструкция

В новой инструкции есть данные об отсутствии перекрестных реакций с другими гормонами и влияния некоторых веществ:

Перекрестные реакции

Обратная сторона коробочки:

Теперь опускать тест в мочу нужно на 3 секунды (раньше было 5 секунд).

Оценивать результат теперь нужно через 1-3 минуты, но не позднее 5 минут (раньше через 3-5 минут, но не позднее 10 минут).

Так что, новый тест реагирует быстрее.

Сами полосочки тоже немного отличаются. Яркость контрольных полос примерно одинаковая. Правда, у нового всё же ярче и чётче.

Новый верхний.


Недостатки в эвитестах я не нашла для себя.

  • Брака не встречавстречала. Если он бывает, то встречается очень редко.
  • Ложноположительных не было ни разу. Не всегда он именно ложный. Т.к. может быть гормональный сбой, биохимическая беременность, опухоль (когда ХГЧ тоже может повышаться в организме).
  • Чувствительность хорошая. Не ведитесь на чувствительность ниже 20 мМЕ/мл. Это маркетинговый ход.
  • Тест качественный. Произведен в Германии.
  • Быстрый результат. Через 1-3 минуты уже можно оценивать результат.
  • На малых сроках, естественно, полоска будет не такая яркая, как контрольная. Вы должны это понимать. Так на всех тестах, кроме электронного.
  • Цена не самая низкая, но примерно такая же, как у подобных тестов в такой упаковке.
  • Если вам не удобно использовать, берите другие тесты (струйные, электронные). Стрип-тесты в использовании одинаковы.


В общем, Эвитест для меня был и остаётся самым надёжным тестом. После него только анализ крови на ХГЧ.

(PDF) Акушерская допплерография у овец на поздних сроках беременности, осложненных гангренозным маститом


Сравнение ультразвуковых изображений (УЗИ), полученных с помощью

двух различных (механических секторных и линейных) зондов и

макроскопических характеристик репродуктивных органов крупного рогатого скота:

биометрических исследований

К. Пиотровска-Томала, М. Бах, П. Вармовски и Д. Скаржински

Институт репродукции животных и исследований пищевых продуктов Польской академии

наук, Ольштын, Польша

В ветеринарной практике ультразвуковое исследование стало важным —

— неинвазивный, безболезненный диагностический инструмент для оценки

диагностики беременности и нарушений репродуктивной системы.Это исследование

было разработано для сравнения биометрических измерений репродуктивных органов

с использованием секторных или линейных сканеров

с макроскопическими измерениями (посмертными) у 24 коров.

Использовались сканеры двух типов: Draminski ANIMALPro

(www.draminski.com): механический сектор (ректальный 3,5 / 5,0 /

7,0 МГц; 180 °) и линейный массив (ректальный; 7,5 МГц). Корпуса

lutea (CL) были визуализированы в 16 яичниках, фолликулы в 13 яичниках и


были обнаружены в шести яичниках.Эндометрит или пиометра был диагностирован в шести матках

, а беременность (8–10 недель) — в одной матке

. Не было значительных различий между изображениями

, полученными с использованием секторных или линейных преобразователей, и макроскопическими элементами

. Обнаружена высокая корреляция между посмертными биометрическими измерениями

исследованных органов и мониторингом у

животных в сознании с помощью секторных или линейных зондов: CL



= 0.89, r


= 0,82), фолликулы (r


= 0,77, r


= 0,78) и

толщину стенки матки (r


= 0,93, r


= 0,81;

соответственно, p <0,001). Как секторные, так и линейные зонды

оказались полезными клиническими и исследовательскими инструментами.


Внедрение породы вальдостана в Бразилии: сравнение массы тела при отъеме

у чистой нелоре и в другой гибриде F1

Nelore и корреляция с пубертатными характеристиками

телок F1

P Pitaluga

da Silva

P Pitaluga

da Silva


, A Ricci


, J Sales


, P Baruselli



L Vincenti


9000 Medicina 1


, DP

Patologia Animale,

Grugliasco, Италия,


Департамент репродукции

˜o Animal, FMVZ — USP;


˜o Paulo, Бразилия

Масса тела при отъеме и следующий период полового созревания составляли

по сравнению с чистым Nelore (N) и другим кроссом N-F1 —

пород, рожденных IATF, в двух разных фермы, расположенные в Mato

Grosso, Бразилия.В общей сложности 806 телят F1 (Valdostana-Valore


Charolais, Red и Aberdeen Angus) содержались на пастбище Brachiaria

brizantha до отъема, и только 608 получили

дополнительных протеиновых добавок. Все животные были взвешены электронным способом на

при отъеме (7 ± 1 месяц), а самкам в возрасте 12 месяцев была проведена оценка репродуктивных

трактов. Влияние

породы на массу тела при отъеме составило

, проанализированное с помощью ANOVA (SAS 9.1, 2000) с учетом секса и фермы в счете

. Корреляция с половым развитием была проанализирована с помощью метода хи-квадрат

. На ферме I, F1 Valore

самок и самцов были тяжелее (201 и 207 кг соответственно)

при отъеме, чем F1 Red и Aberdeen Angus (186–189 и

174–181 кг, p <0,05), Nelore (176 p <0,05 и 196 кг

p> 0,05) и F1 Шароле (196–202 кг p> 0,05). Примерно

половой статус: 55% телок Valore

телок достигают половой зрелости в

через 12 месяцев на ферме I и 10% на ферме II по сравнению с15% F1

Charolaise и 7,4% F1 Red Angus (Ферма I) и ни одного в

Nelore. F1 Valore

, кажется, имеет лучший вес при отъеме

, а телки имеют более ранний половой возраст, чем другие помеси



Влияние породы, паритета и сезона цикла на продолжительность жизни

репродуктивных параметров у сук

B Polat, A Colak, A Hayirli и M Cengiz

Факультет ветеринарной медицины, Atatu

rk University, Эрзурум, Турция

Статусы размножения и беременности, а также проэструс, течка,

, продолжительность и сезоны беременности, количество щенков,

и интервал цикла были получены от немецких овчарок

(GS, n = 34), лабрадора. (LD, n = 23), Бельгия Malinoa

(BM, n = 13) и пойнтеры (PO, n = 9) в течение 10 паритетов до

оценивают влияние породы, паритета и сезона цикла на

репродуктивных параметров. .Данные были подвергнуты процедурам FREQ,

CORR и MIXED. Раритет отрицательно коррелировал с интервалом цикла (r =) 0,18) и продолжительностью проэструса

(r =) 0,09), а также количеством щенков (r =

) 0,20), но не коррелировал с течением и твердой мозговой оболочкой беременности. —

тион. Средний возраст полового созревания не отличался для породы

(464,8 ± 26,2 дня, p <0,30). На коэффициент размножения повлияли

породы (83,2, 60,1, 71,8 и 72.1% для GS, LD, BM и

PO соответственно, p <0,0001). Тем не менее, частота наступления беременности

не различалась для разных пород (74,6%, p <0,12). На продолжительность беременности

повлияла порода (63,7, 63,5, 62,2 и

65,2 дня для G, L, B и P, соответственно, p <0,02). С возрастом

продолжительность беременности не изменилась (p <0,33),

, но количество щенков линейно уменьшилось с 6,9 при 1-м оплодотворении

до 5,6 при 10-м оплодотворении (p <0.03). Интервал цикла

варьировался в зависимости от породы (208,2, 215,1, 208,6 и 237,0 дней для

GS, LD, BM и PO, соответственно, p <0,01), который также уменьшился линейно с 241,1 до 202,0 в качестве паритета. увеличилось с

1 до 10 (p <0,04). На продолжительность проэструса не повлияла порода

(8,8 ± 0,3 дня, p <0,20). Однако продолжительность течки

варьировала в зависимости от породы (9,5, 8,5, 8,0 и 8,2 дня для GS, LD,


BM и PO соответственно, p <0.001). Таким образом, на

широте Турции репродуктивные параметры

у сук GS, LD, BM и PO не меняются.


Изменения кровотока в яичниках в реальном времени у кроликов во время

PGF2a-индуцированный лютеолиз

A Polisca


, R Orlandi


, G



, F Parillo



M Maranesi


и C Boiti



Dipartimento di Patologia, Diagnostica di

, Dipartimento di Patologia, Diagnostica di 2 9000 Sci-Fi Biopatologiche Veterinarie, Университет

Перуджа, Италия,


Scuola di Scienze Mediche Veterinarie, Университет

Camerino, Matelica, Италия

Динамическое изменение кровотока яичников контролировалось

с помощью ультразвукового исследования

эстральные и псевдобеременные кролики

до и после лечения лютео-

литической дозой PGF2a.Псевдобеременность вызывалась 20 МЕ

eCG, а через 2 дня — 0,8 lg GnRH (день 0). У

кроликов, страдающих течением, PGF2achallenge вызывал временное снижение кровотока в яичниках (p <0,05), оцениваемое с помощью числа записанных пикселей

, в течение 20 минут. Через 50 минут после

PGF2a кровоток вернулся к базальным значениям, но после

он постепенно увеличился почти в два раза (p <0,01) 90 минут

Abstracts 141

2011 Blackwell Verlag GmbH

Внеклеточный матрикс поверхность регулирует самосборку трехмерных сфероидов трофобласта плаценты


Включение внеклеточного матрикса (ECM) необходимо для создания моделей in vitro , которые действительно представляют микроархитектуру, обнаруженную в тканях человека.Однако взаимодействия клетка-клетка и клетка-ECM in vitro остаются плохо изученными в биологии плацентарного трофобласта. Мы исследовали влияние изменения свойств поверхности (толщины и жесткости поверхности) двух внеклеточных матриц, коллагена I и матригеля, на морфологию плацентарных клеток трофобласта, жизнеспособность, пролиферацию и экспрессию маркеров, участвующих в дифференцировке / синцитиальном слиянии. В частности, было обнаружено, что более толстые поверхности матригеля вызывают самосборку клеток трофобласта в трехмерные сфероиды, которые демонстрируют зависящие от толщины изменения профилей жизнеспособности, пролиферации, синцитиального слияния и экспрессии генов по сравнению с двумерными культурами.Изменения в организации F-актина, морфологии распространения клеток и профилях экспрессии генов интегрина и матриксной металлопротеиназы дополнительно показывают, что реакция на толщину поверхности может частично опосредоваться механизмами определения жесткости клеток. Получение нами самосборных сфероидных культур трофобластов посредством регуляции только поверхности ECM способствует более глубокому пониманию взаимодействий между клетками и ECM и может иметь важное значение для развития платформ in vitro и для исследований или диагностики.


Плацента человека играет ключевую роль в росте и выживании плода во время беременности из-за ее участия в обмене матери и плода, иммунной и барьерной защите и эндокринной регуляции [1, 2]. Для понимания сложных процессов, лежащих в основе этой быстро развивающейся ткани, требуется широкий спектр экспериментальных подходов, включая модели in vivo и in vitro . В последнее время проявился большой интерес к моделированию функции плацентарного барьера с использованием моделей in vitro , состоящих из монослоев клеток трофобласта или более сложных ансамблей множественных типов клеток, называемых микрофизиологическими системами [3–5].Однако многие из этих платформ in vitro разработаны в отсутствие неклеточного каркаса, присутствующего in vivo , известного как внеклеточный матрикс (ЕСМ) [6, 7]. ЕСМ обычно не включается в большинство систем культивирования, где клетки просто культивируют на двумерных (2D) поверхностях из полистирола или стекла. Известно, что физические свойства этих 2D-поверхностей весьма отличаются от тех, которые существуют in vivo [8]. Принимая во внимание, что ECM предоставляет многочисленные биохимические и биомеханические сигналы, которые важны для регулирования поведения клеток [9], включение ECM для in vitro моделирования и тестирования может иметь центральное значение для точного понимания функции плацентарного барьера.

В то время как важность рассмотрения трехмерных (3D) ECM для in vitro моделей клеточных культур становится очевидной [10], наше понимание регулирующей роли межклеточных взаимодействий на клеточную функцию все еще остается неполным. Специфические для развития плаценты, клетки трофобласта, выращенные на различных ECMs, демонстрируют фенотипические изменения, такие как измененная экспрессия генов и белков, которые указывают на более дифференцированную популяцию [11-15]. Тем не менее, функциональные последствия этих вызванных биоинтерфейсом изменений фенотипа еще предстоит полностью выяснить.В частности, существует несоответствие в нашем понимании таких параметров, как толщина поверхности и жесткость, в контексте биологии трофобласта. Поскольку свойства ECM могут предоставлять ключевые сигналы для управления судьбой и поведением клеток [16, 17], несоответствия в настройке поверхности роста могут иметь последствия для трансляции полученных результатов. Следовательно, необходимо понять, как параметры ЕСМ, используемые во время культивирования in vitro , влияют на рост и функцию трофобластов. В то время как в литературе не приводятся четко определенные измерения толщины и жесткости ВКМ плаценты человека, мы знаем, что изменения этих параметров связаны с патологиями плаценты, такими как ограничение внутриутробного развития [18].Следовательно, при разработке микрофизиологических систем in vitro отсутствие четкого определения ECM может привести к ненормальному представлению клеточной функции.

В текущем исследовании мы исследовали влияние ЕСМ на клетки плацентарного трофобласта in vitro . Мы предположили, что изменение толщины и жесткости поверхности ECM может влиять на клеточную организацию, функцию и профили экспрессии. Более глубокое понимание обусловленных биоинтерфейсом эффектов толщины ВКМ на фенотип клеток трофобласта будет иметь фундаментальное значение при разработке более in vivo -подобных моделей для исследования беременности, тестирования лекарств / токсинов и прогноза патологий плаценты.

Материалы и методы

Изготовление поверхности гидрогеля ЕСМ

Коллаген I (Corning; 2 мг / мл) и матригель (Corning; 5 мг / мл) использовались в качестве гидрогелей ЕСМ для этого исследования, поскольку они являются двумя из наиболее часто используемых гидрогелей. использовали ростовые поверхности ECM для клеток [19, 20]. Матригель — это восстановленный экстракт базальной мембраны саркомы мышей Engelbreth-Holm-Swarm, который состоит примерно из 60% ламинина, 30% коллагена IV, 8% энтактина и других белков и факторов роста (Corning).В этом исследовании использовался матригель с пониженным содержанием факторов роста, чтобы минимизировать влияние факторов роста и повысить сопоставимость с коллагеном I, который также не содержит факторов роста [21]. Две толщины поверхности (50 и 250 мкм) были выбраны на основе наиболее часто используемых диапазонов, ранее замеченных в литературе для культуры трофобластов [11-15]. Для расчета объема гидрогеля, необходимого для получения удельной толщины поверхности, использовали следующее уравнение: Объем = (площадь поверхности роста клеток) x (расчетная толщина) .Контролируемый объем жидкого гидрогелевого материала наносили на стеклянные или полистирольные поверхности с помощью микропипетирования и равномерно распределяли по поверхности. Матригель превращали в гель путем инкубации при 37 ° C в течение 1 часа. Коллаген I превращали в гель путем добавления 10X фосфатно-солевого буфера (PBS) и 1 н. Гидроксида натрия и инкубировали при 37 ° C в течение 1 часа в соответствии с протоколом производителя.

Анализ свойств поверхности ЕСМ и механическое испытание жесткости подложки

Анализ и механические испытания поверхностей ЕСМ проводились с использованием прибора MicroSquisher (CellScale).Изображения получали с помощью камеры MicroSquisher, а данные записывали с помощью программного обеспечения SquisherJoy (CellScale). Фактическая толщина поверхностей была измерена путем визуализации поперечного сечения гидрогеля и покровного стекла и с использованием измерительного инструмента в программном обеспечении SquisherJoy. В общей сложности было выполнено пять измерений для каждого образца вдоль края к центру поверхности ECM.

Стальная пластина 2 мм x 2 мм, приклеенная к цилиндрической консоли диаметром 203,2 мкм, использовалась для проведения механических испытаний в эксперименте.Все образцы тестировали в солевой бане с фосфатным буфером при комнатной температуре. Кантилевер опускали до тех пор, пока он не касался верхней части образца ECM. Образцы сжимали до 10% инженерной деформации со скоростью деформации 1,61 мкм / секунду и выдерживали при постоянной деформации в течение 10 с с последующей скоростью деформации высвобождения 1,61 мкм / секунду. Сила измерялась во время цикла сжатия, деформации и освобождения. Все гели показали эластичную область между 3–5% значений деформации, которые использовались для анализа.Жесткость подложки определялась путем оценки силы, необходимой для сжатия образца до постоянного смещения.

Клеточная культура

Клетки BeWo (ATCC) — одна из наиболее широко используемых клеточных линий в исследованиях трофобластов плаценты для моделирования ворсинчатых трофобластов, синцитиального слияния и многих аспектов функции и заболеваний плаценты [22, 23]. Клетки BeWo культивировали при 37 ° C в 95% комнатном воздухе / 5% CO 2 в среде F-12 (Corning) с добавлением 10% фетальной бычьей сыворотки, 1% L-глутамина и 1% пенициллин-стрептомицина.СМИ меняли каждые два дня. Клетки между пассажами 10-15 использовали для всех экспериментов и высевали с начальной плотностью 1×10 4 клеток / см 2 на стеклянные покровные стекла или 6-луночные полистирольные планшеты, которые были либо без покрытия (2D контроль), либо с покрытием с разной толщиной коллагена I или Матригеля.

Визуализация живых клеток клеточной организации

Клетки были визуализированы под фазово-контрастным фильтром, и изображения были получены с использованием инвертированного микроскопа AE2000 (Motic) и камеры Moticam X2 (Motic).Изображения клеточной организации были получены при 4-кратном увеличении объектива.


Клетки фиксировали в течение 10 минут в 2% параформальдегиде с 0,1% глутаральдегидом и в течение 5 минут подвергали проницаемости с помощью 0,1% тритона X-100 в PBS. Затем образцы блокировали в течение 2 часов с использованием 0,01% Твина-20, 10% козьей сыворотки и 1% бычьего сывороточного альбумина (БСА) в PBS. После этого образцы инкубировали с любым первичным антителом против E-кадгерина (Abcam; ab40772; кроличий моноклональный; 1: 500) в течение ночи при 4 градусах, а затем инкубировали с козьим анти-кроличьим IgG H&L вторичным антителом Alexa Fluor® 488 (Abcam; ab150077 ; козий поликлональный; 2 мкг / мл) в течение 1 часа или с реагентом CytoPainter Phalloidin-iFluor 555 (Abcam; ab176756; 1: 1000) в течение 1 часа.Все блокирование и инкубации проводили при комнатной температуре, если не указано иное. Образцы контрастировали 4 ‘, 6-диамидино-2-фенилиндол дигидрохлоридом (DAPI; Santa Cruz; 1,5 мкг / мл) и помещали на предметные стекла с использованием водной среды для закрепления Fluoromount ™ (Sigma-Aldrich). Слайды визуализировали с помощью инвертированного флуоресцентного микроскопа Eclipse Ti-E (Nikon). Изображения Z-стека были получены с шагом 0,5 мкм для захвата всех слоев. Изображения были проанализированы с использованием программного обеспечения Fiji (Национальные институты здравоохранения) и NIS Elements (Nikon).Чтобы оценить синцитиальное слияние, E-Cadherin визуализировали для идентификации границ клеток (поскольку E-Cadherin локализован на плазматической мембране [24]) и DAPI для идентификации ядер клеток. При слиянии E-Cadherin и DAPI позволили визуализировать синцитиальное слияние [25]. Слияние клеток можно количественно оценить с помощью следующего уравнения [26]: Общий процент слияния (%) = (Количество ядер в синцитии / Общее количество ядер) x 100% . Площадь распространения клеток определяли путем количественного определения бинарной площади окрашивания фаллоидином, нормированной на среднюю интенсивность DAPI в качестве показателя количества клеток [27].

Жизнеспособность и пролиферация клеток

Клетки BeWo инкубировали с кальцеином AM (Thermo Scientific; C1430; 1: 200) и гомодимером этидия-1 (Thermo Scientific; E1169; 1: 200) и визуализировали с использованием инвертированной флуоресценции Eclipse Ti-E. Микроскоп (Nikon). Зеленая флуоресценция указывает на живые клетки, а красная флуоресценция указывает на мертвые клетки. Изображения были проанализированы с использованием программного обеспечения Fiji (Национальные институты здравоохранения) и NIS Elements (Nikon), и процентное соотношение живых и мертвых клеток было рассчитано путем деления средней интенсивности живых клеток (определяемой по флуоресценции окраски Calcein AM) на средняя интенсивность мертвых клеток (определяемая по флуоресценции красителя гомодимера-1 этидия).

Пролиферацию клеток определяли с использованием набора CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay (анализ MTS; Promega). Поглощение измеряли при 490 нм на спектрофотометре Multiskan® Spectrum (Thermo Scientific). Учитывая, что оптическая плотность прямо пропорциональна количеству живых клеток, относительную скорость пролиферации клеток определяли путем расчета кратного изменения оптической плотности по сравнению с 2D контролем. Образцы матригеля без засеянных клеток использовали для корректировки любого потенциального фонового поглощения.

Экстракция РНК и количественная полимеразная цепная реакция в реальном времени (кПЦР)

Клетки выделяли из гидрогелей с использованием раствора для восстановления клеток (Corning). Полную РНК экстрагировали из клеток с использованием реагента TRIzol (Invitrogen) и набора Direct-zol RNA MiniPrep (Zymo Research) в соответствии с протоколом производителя. Всего 1 мкг РНК подвергали обратной транскрипции в кДНК с использованием набора для обратной транскрипции кДНК высокой емкости (Applied Biosystems). Наборы праймеров, направленные против представляющих интерес генных мишеней, были разработаны с помощью инструмента разработки праймеров Primer-BLAST Национального центра биотехнологической информации и синтезированы в McMaster’s Mobix Labs ( ).Количественный анализ экспрессии мРНК проводили с помощью кПЦР с использованием флуоресцентного красителя нуклеиновых кислот PerfeCTa SYBR Fastmix (Quanta) и системы обнаружения ПЦР в реальном времени CFX384 Touch (BioRad). Условия цикла были 95 ° C в течение 10 минут, затем 40 циклов при 95 ° C в течение 10 секунд, 60 ° C в течение 10 секунд и 72 ° C в течение 15 секунд. Относительные кратные изменения были рассчитаны с использованием метода сравнительного времени цикла (Ct), нормализующего все значения к эндогенному контрольному гену (18S). Эндогенный контрольный ген был выбран на основании экспериментально определенной стабильности Ct во всех группах лечения.Учитывая, что все наборы праймеров имели одинаковую эффективность прайминга, значения ΔCt для каждого набора праймеров были откалиброваны по среднему значению всех контрольных значений Ct, а относительная численность каждого набора праймеров по сравнению с калибратором была определена по формуле 2 ΔΔCT в где ΔΔCt было нормированным значением. Образцы матригеля без засеянных клеток также анализировали, чтобы убедиться, что любые потенциальные следы РНК, обнаруженные только в гидрогелях, не искажают измерения.

Таблица 1

Прямые и обратные последовательности для праймеров, используемых для кПЦР.

+ GCCATTGACACCTACTCAG T type ":" entrez-нуклеотид "," attrs ": {" text ":" V00573.1 "," term_id ":" 35506 "," term_text ":" V00573.1 "}} V00573.1 9045 {"type": "entrez-нуклеотид", "attrs": {"text": "NM_181501.1", "term_id": "31657141", "term_text": "NM_181501.1"}} NM_181501.1 9046GAGGATCTTGCC
Джин Форвард Обратный GenBank
18S (RNA18S5) CACGCCAGTACAAGATCCCA AAGTGACGCAGCCCTCTATG { «Тип»: «Entrez-нуклеотид» , «attrs»: {«text»: «NR_003286.2», «term_id»: «225637497», «term_text»: «NR_003286.2»}} NR_003286.2
Glial Cells Missing Homolog 1 (GCM1 ) CCTCTGAAGCTCATCCCTTGC ATCATGCTCTCCCTTTGACTGG {«type»: «entrez-нуклеотид», «attrs»: {«text»: «NM_003643.3 «,» term_id «:» 215598886 «,» term_text «:» NM_003643.3 «}} NM_003643.3
Плацентарный лактоген (PL) GCCATTGACTACCTC T
Эндогенный ретровирус, группа W, член 1, оболочка; синцитин-1 (ERVWE1) GTTAATGACATCAAAGGCACCC CCCCATCTCAACAGGAAAACC {"тип-текст": "ядро", "тип-текст": "entors NM_014590 "," term_id ":" 48949850 "," term_text ":" NM_014590 "}} NM_014590
Группа эндогенных ретровирусов FRD Member 1, Envelope; Syncytin-2 (ERVFRD1) 8 GCCT ATCC GCTGTCCCTGGTGTTTCAGT {"тип": "энтрез-нуклеотид", "attrs": {"текст": "NM_207582.2 "," term_id ":" 25

35 "," term_text ":" NM_207582.2 "}} NM_207582.2
Хорионический гонадотропин, альфа (CGA) GCAGGATTGCCCAGAATG45 GCAGGATTGCCCAGAATGC 9045 {"type": "entrez-нуклеотид", "attrs": {"text": "V00518.1", "term_id": "31868", "term_text": "V00518.1"}} V00518.1
Хорионический гонадотропин,
бета (CGB)
ACCCCTTGACCTGTGAT CTTTATTGTGGGAGGATCGG ", текст", "тип", "текст", "текст:", текст "," текст "," текст "," текст "," текст "," текст "," текст "," текст "," текст "," текст "," текст "," тип J: ".1 "," term_id ":" 180436 "," term_text ":" J00117.1 "}} J00117.1
Матричная металлопротеиназа (MMP) 2 TCTCCTGACATTGACCTTGGC 90CTAG45 CAGACCTTGGC 90CAG45 "type": "entrez-нуклеотид", "attrs": {"text": "NM_004530.5", "term_id": "700274108", "term_text": "NM_004530.5"}} NM_004530.5
MMP9 CCGGCATTCAGGGAGACGCC TGGAACCACGACGCCCTTGC {"type": "entrez-нуклеотид", "attrs": {_ "text": "attrs": {_ "text": ".2 "," term_id ":" 74272286 "," term_text ":" NM_004994.2 "}} NM_004994.2
Тканевый ингибитор металлопротеиназ (TIMP) 1 GGGCTTCACCAAGAC8 {"type": "entrez-нуклеотид", "attrs": {"text": "NM_003254.2", "term_id": "73858576", "term_text": "NM_003254.2"}} NM_003254.2
TIMP2 GAAGAGCCTGAACCACAGGT GGGGGAGGAGATGTAGCAC {"type": "entrez_00 nucleotide", text "attrs": "attrs".4 "," term_id ":" 73858577 "," term_text ":" NM_003255.4 "}} NM_003255.4
Субъединица интегрина альфа (ITGA) 1 CAGTCTATCCACGGAGTCAAT8GATC1
ITGA5 CCAAAAGAAGCCCCCAGCTA TCCTTGTGTGGCATCTGTCC {"type": "entrez_00", "text attrs205": {4 "," term_id ":" 1017029566 "," term_text ":" NM_002205.4 "}} NM_002205.4
ITGAV TCACTAAGCGGGATCTTGCC entrez-nucleotide "," attrs ": {" text ":" EF560727.1 "," term_id ":" 148342505 "," term_text ":" EF560727.1 "}} EF560727.1
Integrin Subunit Beta (ITGB) 3 GAAGCAGAGTGTGTCACGGA TGCATCATTCCTCCAGCCAA {"type": "entrez-нуклеотид", "attrs": {"text12:" NM_0002.2 "," term_id ":" 47078291 "," term_text ":" NM_000212.2 "}} NM_000212.2

Enzyme-Linked Immunosorbent Assay (ELISA)

Клеточная среда была собрана и уровни секретированного hCGβ были проанализированы с помощью ELISA. Вкратце, 96-луночные микротитровальные планшеты из полистирола с высоким связыванием (Costar) были покрыты детектором анти-hCGβ-антителом (Meridian; mAF05-19; моноклональная мышь; 2,94 мкг / мл) в течение 2 часов, а затем заблокированы. с 1% BSA в трис-забуференном физиологическом растворе в течение ночи при 4 ° C. Затем образцы среды инкубировали в лунках в течение 2 часов.Планшеты инкубировали с репортерным антителом против ХГЧ (Hytest; 27E8; моноклональная мышь; 0,3 мкг / мл), конъюгированным с пероксидазой хрена, в течение 1 часа. Затем планшеты инкубировали с субстратом TMB (Sigma; T8665) в течение 30 минут. Поглощение измеряли при 550 нм и 450 нм на спектрофотометре Multiskan® Spectrum (Thermo Scientific), и значения 450 нм вычитали из значений 550 нм, чтобы исправить оптимальные дефекты микропланшета. Уровни протеина были нормализованы по абсорбции, рассчитанной на основе анализа пролиферации MTS, поскольку абсорбция прямо пропорциональна количеству живых клеток (метод адаптирован из [15]).

Статистический анализ

Все статистические анализы были выполнены с использованием программного обеспечения Prism 5 (GraphPad). Результаты выражали как среднее значение нормализованных значений ± стандартная ошибка среднего (SEM). Эксперименты повторяли не менее трех раз (n ≥ 3), если не указано иное. Значимость различий (p <0,05) между нормализованными средними значениями затем оценивали с использованием непарного t-критерия или однофакторного дисперсионного анализа (ANOVA) с последующим пост-тестом Тьюки, в зависимости от условий эксперимента.


Тип и толщина поверхности ЕСМ по-разному регулируют клеточную организацию и морфологию

Клетки BeWo высевали на 2D-поверхности полистирола, тонкие или толстые поверхности коллагена I или матригеля, и живую клеточную организацию исследовали с помощью фазово-контрастной микроскопии. Различия в клеточной организации наблюдались в течение 24 часов после посева (день 1; ), при этом длинная нитевидная морфология, особенно очевидная на тонких поверхностях Matrigel ( ), и небольшие агрегаты, видимые на толстых поверхностях ( ).К 7 дню клетки BeWo, культивированные на тонком коллагене I и матригеле, оказались более плотно заселенными, чем 2D-контроль, но сохранили пластинчатый сливной рост и больше не были различимы с точки зрения клеточной организации ( ). Однако клетки BeWo, культивируемые на толстом коллагене I, образовывали неопределенные агрегаты на 7 день ( ), тогда как клетки, культивированные на толстом матригеле, самоорганизовывались в отдельные сфероидальные агрегаты на 7 день ( ). К 21 дню клетки BeWo, культивируемые на тонких поверхностях, больше не отличались по организации от 2D-контроля ( ).Напротив, культуры, выращенные на толстых образцах коллагена I, не показали различий по сравнению с 2D контролем ( ). Примечательно, что толстые сфероиды трофобласта, индуцированные матригелем, сохраняли форму и целостность, но увеличивались в размерах с 7 по 21 день ( ). В совокупности толстые поверхности требовались для формирования агрегатов, а толстый матригель требовался специально для самосборки и обслуживания сфероидов.

Толстый матригель регулирует самосборку сфероидов трофобласта, что определяется визуализацией живых клеток.

Клетки BeWo, культивированные в течение 1 дня на (A) контрольной поверхности 2D, (B) тонком коллагене I, (C) тонком матригеле, (D) толстом коллагене I и (E) толстом матригеле. Клетки BeWo выращивали в течение 7 дней на (F) 2D контрольной поверхности, (G) тонком коллагене I, (H) тонком матригеле, (I) толстом коллагене I и (J) толстом матригеле. Клетки BeWo выращивали в течение 21 дня на (K) 2D контрольной поверхности, (L) тонком коллагене I, (M) тонком матригеле, (N) толстом коллагене I и (O) толстом матригеле. Все изображения были сделаны при 4-кратном увеличении объектива, масштабная линейка показывает 500 мкм.n = 3.

Матригель привел к зависящему от толщины увеличению жизнеспособности и пролиферации клеток

Самосборка, трехмерные клеточные сфероиды и микроткани представляют большой интерес, поскольку, как было показано, они лучше воспроизводят фенотипы, пахнущие их соответствующих органов, по сравнению с двумерные (2D) культуры, такие как тканеспецифическая плотность клеток, микроархитектура, межклеточные взаимодействия [10, 28–31]. Учитывая потенциальную ценность, мы дополнительно охарактеризовали толстые матригель-индуцированные сфероиды трофобластов на 7 день.Жизнеспособность клеток, определяемая по соотношению живых и мертвых клеток, значительно увеличивалась в зависимости от толщины (p <0,05 для 2D в тонкую; p <0,001 для 2D в толстую; p <0,01 для тонкой в ​​толстую; ) , с наибольшей жизнеспособностью в клетках, выращенных на толстой поверхности матригеля (91,3 ± 0,2%). Интересно, что среднее значение скорости пролиферации клеток, по-видимому, увеличивалось в зависимости от толщины, со значительными различиями, очевидными в толстой поверхности матригеля по сравнению с двумя другими группами (181.0 ± 29,3%, p <0,001 для 2D до толстой; р <0,05 для тонких и толстых; ).

Зависимое от толщины увеличение жизнеспособности и пролиферации клеток в клетках BeWo, культивируемых на матригеле, через 7 дней.

(A) Иммунофлуоресцентные изображения клеток BeWo, окрашенных кальцеином AM (зеленый) и гомодимером этидия-1 (красный). Все изображения были сделаны при 10-кратном увеличении объектива, масштабная линейка показывает 100 мкм. (B) Процентное соотношение средней интенсивности живых и мертвых клеток, культивируемых на 2D, тонких и толстых поверхностях.(C) Относительные скорости пролиферации клеток, культивируемых на 2D, тонких и толстых поверхностях, по оценке с помощью анализа MTS. Значительные различия между группами лечения, определенными односторонним дисперсионным анализом с последующим пост-тестом Тьюки; n ≥ 3. Значимые различия между средними значениями, определенными в результате тестирования, были обозначены * (p <0,05), ** (p <0,01) или *** (p <0,001).

Влияние толщины поверхности ECM на синцитиальное слияние

Из-за сильного воздействия на клеточную организацию, самосборку сфероидов, жизнеспособность и пролиферацию, мы исследовали влияние толщины поверхности на синцитиальное слияние, которое является важным признаком синцитиотрофобласта дифференциация.Интересно, что клетки BeWo, выращенные на толстом матригеле, оказались очень сильно слитыми с минимальным окрашиванием E-кадгерином в центре сфероидов по сравнению с клетками, выращенными на 2D или тонком матригеле ( ). Однако из-за высокой плотности кластеризации DAPI-положительных ядер на тонких и толстых поверхностях матригеля было невозможно точно отличить ядра друг от друга, что препятствовало точному количественному определению процента синцитиального слияния. Таким образом, мы оценили степень синцитиального слияния посредством профилирования экспрессии генов, чтобы проверить это качественное увеличение слияния, наблюдаемое в толстых матригель-индуцированных сфероидах.

Иммунофлуоресцентное окрашивание E-кадгерина и DAPI для визуализации синцитиального слияния.

Клетки BeWo, выращенные на (A) 2D, (B) тонких поверхностях Matrigel или (C) толстых поверхностях Matrigel. Зеленая флуоресценция указывает на окрашивание E-кадгерином, а синяя флуоресценция указывает на окрашивание DAPI ядер клеток. Изображения были получены при 20-кратном увеличении, масштабная линейка показывает 100 мкм.

Сфероиды, индуцированные толстым матригелем, показали значительное двукратное увеличение уровней мРНК глиальных клеток, в которых отсутствует гомолог 1 ( GCM1 ), фактор транскрипции для многих генов, связанных с синцитиализацией [32], по сравнению с клетками, выращенными на 2D-поверхностях ( р <0.05; ). Уровни мРНК лактогена плаценты ( PL ) были значительно увеличены в зависимости от толщины (p <0,01 для 2D до тонкого; p <0,001 для 2D до толстого; ). Уровни мРНК члена 1 группы W эндогенного ретровируса ( ERVWE1 ) увеличивались только в группе тонкого матригеля (p <0,05 для 2D to thin; ), но уровни мРНК члена 1 группы FRD эндогенного ретровируса ( ERVFRD1 ) резко снижались ( p <0,01 для 2D и толстых; p <0.05 от тонкого до толстого; ). Уровни мРНК хорионического гонадотропина α ( CGA ) человека не изменились ( ), но уровни мРНК хорионического гонадотропина β ( CGB ) были значительно увеличены в зависимости от толщины (p <0,05 для 2D to тонкое; p < 0,001 для 2D и толстых; p <0,01 для тонких и толстых; ). В совокупности только толщина / жесткость поверхности была способна вызвать увеличение нескольких ключевых маркеров синцитиального слияния ( GCM1 , PL , ERVWE1 , CGB ).

Влияние толщины матригеля на генные маркеры дифференцировки и синцитиального слияния.

Нормализованные уровни мРНК (A) GCM1 , (B) PL , (C) ERVWE1 , (D) ERVFRD1 , (E) CGA и (F) CGB после 7 дни роста на различной толщине поверхности. (E) Нормализованные уровни белка секретируемого hCGβ в среде. Значительные различия между группами лечения, определенными односторонним дисперсионным анализом с последующим пост-тестом Тьюки; n≥3.Существенные различия между средними значениями, определенными в результате тестирования, были обозначены * (p <0,05), ** (p <0,01) или *** (p <0,001).

Соответственно, одна только толщина поверхности также вызывала значительное увеличение уровней секретируемого белка хорионического гонадотропина β ( hCGβ) человека в клеточной среде (p <0,05; ).

Влияние толщины матригеля на секрецию хорионического гонадотропина β ( hCGβ) человека в клеточную среду.

Нормализованные уровни белка секретируемого hCGβ в среде.Значительные различия между группами лечения, определенными односторонним дисперсионным анализом с последующим пост-тестом Тьюки; n≥3. Значительные различия между средними значениями, определенными в результате тестирования, были обозначены ** (p <0,01).

Реакция клеточной жесткости на изменения толщины поверхности ECM

Поскольку жесткость подложки обратно коррелировала с изменениями толщины поверхности, как видно из наших результатов ( S1, рис. ) и других [16], мы были заинтересованы в дальнейшем выяснении потенциала механизмы определения жесткости, участвующие в формировании сфероидов с толстым матригелем ECM.Способность клеток распространяться по поверхности является известным маркером реакции жесткости [16], и ее можно оценить с помощью иммунофлуоресцентного окрашивания F-актином (фаллоидином). На 3-й день площади распространения клеток значительно уменьшились по мере увеличения толщины поверхности (p <0,001; ), и аналогичная тенденция присутствовала на 7-й день (p <0,001; ).

Толстый матригель приводит к уменьшению площади распространения клеток F-актина.

(A) Иммунофлуоресцентные изображения окрашивания фаллоидином на 3 и 7 дни на различной толщине поверхности.Красная флуоресценция указывает на окрашивание фаллоидином на F-актин, а синяя флуоресценция указывает на окрашивание DAPI на ядра клеток. Изображения были получены при 20-кратном увеличении, масштабная линейка показывает 100 мкм. Средние площади распространения клеток, определяемые путем количественного определения нормализованной бинарной площади окраски фаллоидина на (B) день 3 и (C) день 7. Значительные различия между группами обработки определялись с помощью однофакторного дисперсионного анализа ANOVA с последующим пост-тестом Тьюки; n = 3. Значимые различия между средними значениями, определенными в результате тестирования, обозначены знаком *** (p <0.001).

Гены, активируемые на толстой поверхности ЕСМ, связанные с восприятием жесткости и инвазией

Наконец, мы исследовали влияние толщины матригеля на экспрессию генов, связанных с восприятием жесткости и инвазией / миграцией. На 7 день уровни мРНК ITGA1 и ITGA5 значительно увеличились в клетках, выращенных на тонких и толстых поверхностях Matrigel, по сравнению с 2D контролем (p <0,001 и p <0,05, соответственно; ). Уровни мРНК MMP2 и TIMP1 также значительно увеличились в клетках, выращенных на тонких и толстых поверхностях Matrigel, по сравнению с 2D контролем (p <0.001 и p <0,05 соответственно; ). Уровни мРНК ITGAV , ITGB3 , MMP9 , и TIMP2 существенно не изменились при различной толщине поверхности ( ).

Профили экспрессии генов ответа клеточной жесткости на толщину поверхности ECM.

Нормализованные уровни мРНК (A) ITGA1 , (B) ITGA5 , (C) ITGAV , (D) ITGB3 , (E) MMP2 , (F) MMP9 , (G ) TIMP1 и (H) TIMP2 .Значительные различия между группами лечения, определенными односторонним дисперсионным анализом с последующим пост-тестом Тьюки; n≥3. Существенные различия между средними значениями, определенными в результате тестирования, были обозначены * (p <0,05), ** (p <0,01) или *** (p <0,001).


Настоящее исследование демонстрирует, что природа ЕСМ сама по себе влияет не только на самосборку клеток трофобласта, но также на профили экспрессии генов, связанных с дифференцировкой и взаимодействием клетки с ЕСМ, а также функционально изменяют синцитиальное слияние и секреция гормонов.Способность управлять толщиной поверхности как параметром для изменения жесткости субстрата позволяет оценить, как клеточная функция и фенотип регулируются путем изменения жесткости ECM без изменения состава гидрогеля ECM. Важность изучения таких взаимосвязей подчеркивается в отчетах, которые продемонстрировали, что самособирающиеся сфероиды имеют большую ценность, поскольку, как известно, они обладают клеточными взаимодействиями и плотностями, которые больше похожи на состояние in vivo , чем на 2D культуры [10, 29 , 30].В то время как создание сфероидов плацентарного трофобласта было предпринято несколькими предыдущими исследованиями [33–36], клеточный фенотип и методы, необходимые для их получения, еще не были хорошо описаны. В некоторых исследованиях использовались биореакторы сосудов с неприлипающей или вращающейся стенкой для создания сфероидов, но в этих моделях отсутствуют взаимодействия клетка-ЕСМ, которые необходимы in vivo [33–36]. Наше исследование показывает важность понимания взаимодействий клетка-ECM, чтобы влиять на межклеточные взаимодействия, как видно через образование сфероидов.Важно отметить, что новизна нашей работы демонстрирует, что физические свойства ВКМ вносят вклад не только в клеточную реорганизацию, но также изменяют ключевые клеточные функции, такие как секреция трофобластами ХГЧβ, что имеет решающее значение для регулирования выработки гормонов, слияния трофобластов и инвазии. , и многие другие аспекты здоровья матери и плода in vivo [37, 38]. Эта связь между ECM и клеточной функцией может оказаться жизненно важным фактором в определении неблагоприятных исходов беременности.Следовательно, моделей плацентарной функции in vitro с использованием трофобластов должны учитывать четкое определение ECM, используемого в этих конструкциях.

В данной рукописи мы демонстрируем, что тип ECM играет ключевую роль в регуляции самосборки и поддержания трехмерных сфероидов трофобласта в клетках BeWo. Дифференциальные способности коллагена I и матригеля в поддержании целостности сфероидов согласуются с работой Nguyen-Ngoc, Cheung (39), показывающей, что клетки рака груди человека демонстрируют большую диссоциацию от предварительно сформированных сфероидов опухоли при выращивании на коллагене I или встраивании в него по сравнению с только на Матригель [19, 39].В совокупности это предполагает, что матригель является более подходящим биоматериалом, чем коллаген I, для поддержания целостности трехмерного сфероида трофобласта. Кроме того, дополнительные белки ЕСМ, присутствующие в матригеле ( e . g ., Ламинин, энтактин) по сравнению с 2D-поверхностями или только коллагеном I, также могут способствовать клеточной дифференцировке. Например, нокаут ламинина (субъединица α5) приводил к аномалиям плаценты и эмбриональной летальности у мышей [40], а подавление ламинина α4 или его рецептора приводило к нарушению трофобластических функций ( e . g ., Снижение инвазии, миграции и образования трубок) в клетках трофобласта плаценты человека, что предполагает уникальную роль различных белков ЕСМ в развитии и дифференцировке. Действительно, наши толстые сфероиды трофобластов, управляемые матригелем, демонстрируют более высокую степень синцитиального слияния и профили экспрессии генов ( GCM1 , PL , ERVWE1 , CGB ) и белка (hCGβ), что свидетельствует о более дифференцированной популяции по сравнению с клетками выращены на 2D-поверхностях.Отсутствие изменений, наблюдаемых в уровнях мРНК CGA , не вызывает особого удивления, учитывая известную дифференциальную временную регуляцию экспрессии CGA и CGB во время беременности (где hCGβ обычно достигает пика около 10-12 недель, тогда как hCGα увеличивается постепенно до срока. Важно отметить, что степень слияния, очевидная в клетках BeWo, культивируемых на толстом матригеле, была заметно больше, чем на 2D-поверхностях, в сочетании с увеличением секреции hCGβ, что в совокупности поддерживает усиление слияния клеток за счет увеличения толщины ECM и / или снижения жесткости.Ранее сообщалось, что помимо активации клеточной дифференцировки, поверхности ECM активируют клеточную инвазию [11, 33, 34]. Во время инвазии экспрессия и активность ММП увеличиваются, что приводит к деградации коллагенов [41–44], что также было замечено в нашем исследовании. Поверхность гидрогеля, состоящая исключительно из изолированного коллагена, такого как коллаген I, вероятно, будет более подвержена деградации по сравнению с гидрогелем на основе коктейля белков ЕСМ, таким как Матригель, при столкновении с инвазивными трофобластами, экспрессирующими ММП [41–44]. .Следовательно, отсутствие сфероидных структур на коллагене I на 21 день может быть связано с более высокой степенью деградации поверхности с течением времени, что позволяет клеткам контактировать с покровным стеклом и возвращаться к сплошному росту, тогда как матригель оставался более устойчивым в качестве каркаса из-за более разнообразного Состав ECM. Однако для подтверждения этих предположений необходимы дополнительные исследования, характеризующие белковый состав ЕСМ, а также фактические изменения целостности и топографии поверхности этих поверхностей во время и после инвазии трофобластов.

В то время как агрегация плацентарных клеток, индуцированная гидрогелем, ранее сообщалась в небольшом количестве других исследований [11–13, 15], наше исследование дает более точное определение параметров поверхностного литья ( e . g . , толщина и жесткость поверхности). Наши данные предполагают, что критическая толщина поверхности необходима для образования сфероидов, а вариации толщины могут регулировать фенотип сфероидов. Kliman и Feinberg (14) культивировали первичные трофобласты и клетки JEG3 на постепенном склоне Matrigel (толщина сообщается между 0-60 мкм) и элегантно продемонстрировали вариации морфологии клеток по толщине [14].Хотя они не сообщали об образовании сфероидов из-за короткой продолжительности их исследования (24–72 часа), они действительно видели округлые и индивидуально засеянные клетки при культивировании на матригеле толщиной 14–60 мкм, что напоминало пре-сфероидное состояние. Интересно, что их плацентарные клетки в конечном итоге полностью разрушили более тонкие оболочки Matrigel, чтобы возобновить рост на нижележащем покровном стекле [14]. Это дает правдоподобное объяснение того, почему отдельные цепочечные клеточные образования, наблюдаемые в клетках BeWo, культивируемых на тонком матригеле в день 1, не сохранялись с течением времени.Зависимые от толщины изменения, наблюдаемые в ходе нашего исследования, также предполагают, что клетки могут оценивать свое поведение на основе определения фактической толщины поверхности или, возможно, путем определения другого свойства, на которое непосредственно влияет толщина, например жесткости. В самом деле, сшивание сетей полиэтиленгликоля внутри Matrigel для увеличения жесткости геля было продемонстрировано как изменение поведения инвазии и дисперсии органоидов молочных желез и мезенхимальных стволовых клеток [17, 45]. Другие также постоянно сообщают об увеличении инвазивной активности на поверхностях ECM in vitro в различных типах клеток [39, 46–48].Мы проверили эту гипотезу на нашей модели с помощью механических испытаний, чтобы показать, что толщина ECM обратно коррелирует с жесткостью. Более того, количественное уменьшение распространения клеток коррелирует со снижением жесткости матрикса и предполагает, что клетки трофобласта обладают способностью ощущать толщину ECM через механизмы восприятия жесткости и инвазии. Это также было замечено в работе Mullen et al . (2015) в остеогенных клетках [16]. Интересно, что даже при отсутствии традиционного стимула для вторжения ( i . e ., Градиент питательного вещества или кислорода), небольшое, но значительное, увеличение уровней мРНК ITGA1 , ITGA5, , MMP2 и TIMP1 в клетках BeWo, культивируемых как на тонком, так и на толстом матригеле, аналогичным образом демонстрируя, что присутствие ECM достаточно, чтобы вызвать экспрессию некоторых основных генов. Понятно, что субъединицы интегрина αv, α5, α1 и / или β3 связываются с актиновым цитоскелетом через точки привязки киназ фокальной адгезии, регулируя экспрессию MMP и последующую клеточную инвазию посредством клеточного механо-чувствительного пути [49–53].Однако, несмотря на способность к инвазии, клетки BeWo традиционно демонстрируют менее инвазивный фенотип [54], что может частично объяснить, почему мы не наблюдали устойчивых изменений по всем генам ( e . g ., ITGAV , ITGB3 , MMP9 , и TIMP2 ). Дополнительные исследования должны изучить влияние более сильного стимула для инвазии ( i , e ., Градиент питательных веществ или кислорода) на фактическую инвазию сфероидов и наличие дополнительных генов инвазии / миграции ( ITGAV , ITGB3 , MMP9 , TIMP2 , и т. Д. .) также может измениться.

Образование сфероидов также совпало с зависящим от толщины увеличением экспрессии нескольких генов, связанных с синцитиализацией, GCM1 , PL , CGB и его секретируемого белкового продукта, hCGβ. В то время как человеческий CG продуцируется несколькими типами плацентарных клеток, его основным источником являются синцитиотрофобласты - фузогенные, непролиферативные, терминально дифференцированные эндокринные клетки [55]. Фактически, повышенная экспрессия CG в сфероидах наших трофобластов действует как биохимический маркер дифференцировки и слияния синцитиотрофобластов [32, 56], тем самым обеспечивая полуколичественное подтверждение повышенного синцитиального слияния, наблюдаемого на иммунофлуоресцентных изображениях толстых сфероидов, полученных из матригеля.Интересно, что это увеличение совпало с минимально измененным уровнем мРНК ERVWE1 и снижением ERVFRD1 . Хотя было продемонстрировано, что синцитины играют роль в синцитиальном слиянии, время их экспрессии и функциональное участие остаются неясными [57]. Например, у мышей с нокаутом Syncytin-B и (аналогично ERVFRD1 / syncytin-2 у людей) наблюдалась аномальная плацентация, но плаценты все еще демонстрировали некоторую синцитиализацию, и потомство было жизнеспособным, что свидетельствует о компенсаторных механизмах или существовании альтернативные фузогенные белки [58].Взятые вместе, наши данные предполагают, что Matrigel ECM усиливает умеренное синцитиальное слияние, даже в отсутствие фузогенных агентов, таких как форсколин, но необходимы будущие исследования для дальнейшего профилирования и характеристики сложных паттернов экспрессии генов, лежащих в основе этих изменений. Достигнутая повышенная дифференциация и синцитиализация еще раз подтверждают важность условий ВКМ в моделировании плацентации и подчеркивают преимущества образования сфероидов в культурах трофобластов.

Психология сексуальности | Психология сегодня

Сексуальность делает нас людьми. Естественно, его основная функция - размножение вида. Но очевидно, что секс выходит далеко за рамки мощного эволюционного инстинкта продолжения рода. Секс - это еще и чувственное удовольствие. Удовольствие. Возбуждение. Даже экстаз. В дополнение к земным и земным наслаждениям плоти - трепету от физического прикосновения и прикосновения к другому теплому телу, нарастающему возбуждению к сексуальному освобождению, кульминационному экстазу оргазма и пульсирующему, мирному послевкусию расслабления после оргазма - -человеческая сексуальность также служит как психологическим, так и духовным целям.

Секс - это способ уменьшить наше отчуждение, изоляцию и одиночество путем физического соединения, проникновения или проникновения с другим человеком на самом первичном уровне существования. (См. Мой предыдущий пост.) Секс обосновывает, очеловечивает и воплощает существование. Он вызывает радость, любовь, комфорт, привязанность, а иногда и экстаз.

Экстази - это не только физическое, но и психологическое, а иногда и духовное переживание. Этимология слова «экстаз»: ex-stasis : временное превосходство времени, эго и нашей общей человеческой судьбы экзистенциальной обособленности.Секс связывает нас не только с другим существом, но и с нашим собственным существом и человечеством. Секс, как эрос, из которого он черпает свою глубокую психологическую и духовную силу, - это даймонический : он напоминает нам о нашей внутренней способности быть непроизвольно захваченной в момент оргазма; быть одержимым страстью; сдать контроль. И похоть, и влюбленность - примеры одержимости сексом или эросом.

Эта способность испытывать демонические качества секса или эроса является важной и центральной частью человеческого бытия.Это напоминает нам, что мы, прежде всего, как указывал Фрейд, страстные существа, мотивируемые и движимые примитивными, иррациональными силами, действующими прямо под поверхностью цивилизации и рациональности, гораздо более могущественными, чем наше маленькое маленькое эго.

Секс, как и романтическая любовь, является постоянным напоминанием о нашей иррациональности и его влиянии на нашу с трудом завоеванную рациональность. Это напоминание о нашем неизбежном физическом воплощении. Это унижает наше духовное высокомерие. И это опасно.Понятие «безопасный секс» - оксюморон. Секс, когда он полностью вовлечен, всегда является рискованным делом. Возможная беременность, болезнь, травма и даже смерть сопровождают половой акт на физическом уровне. Влюбленность, одержимость, отвержение, отказ, потеря себя, страх уничтожения, психоз и маниакальное безумие экстаза - все это потенциальные психологические побочные эффекты секса. Один страстный, спонтанный сексуальный контакт может изменить ход жизни в лучшую или в худшую сторону.

На более глубоком уровне сексуальность тесно связана со смертностью.С рождением и смертью. Эта ассоциация изображена в поэтическом представлении Фрейда об Эросе и Танатосе, двух фундаментальных инстинктивных силах человеческого существования, в которых положительный сексуальный «инстинкт жизни» (Эрос) вечно борется с отрицательным «инстинктом смерти» (Танатос). Сексуальность борется со смертью, утверждая жизнь.

В конечном итоге смерть побеждает секс. Но инстинктивная сексуальная энергия или эрос, выраженная в создании детей, художественной работе, заботливых отношениях или героических свершениях, превосходит смерть, преодолевая ее в будущем.Жизнь продолжается, рождается новое поколение, о человеке с любовью вспоминают семья, возлюбленные и друзья, а то, что создано и совершено, живет еще долго после смерти. Эта тесная психологическая связь между сексом и смертью также может быть найдена во французском упоминании сексуального оргазма и его непосредственных последствий как la petite mort , маленькой смерти. В этом смысле секс обеспечивает духовно, психологически и физически обновляющий ритуал смерти и возрождения и конкретное напоминание о экзистенциальной нераздельности этого цикла.

Конечно, секс можно отделить от эроса, от любви и заботы, и в этом случае он становится банальным и механическим. Или его можно заменить на эрос, как, например, в случае сексуальной распущенности. (См. Мой предыдущий пост.) И в некоторых духовных и религиозных традициях секс рассматривается как греховный, злой, слишком плотский или животный характер и отвергается в пользу безбрачия. (См. Мой предыдущий пост о Далай-ламе.)

Естественно, принятие обета не вступать в половую жизнь не приводит к тому, что сексуальный инстинкт просто исчезает, как это доказывают явно извращенные сексуальные наклонности некоторых безбрачных священников.Он находит свое выражение в других формах, в одних положительных и творческих, а в других - отрицательных и деструктивных. Итак, эта первичная сексуальная энергия, которую Фрейд называл «либидо», более или менее всегда с нами на протяжении всей жизни, начиная с рождения и до старости. Оно может увеличиваться и уменьшаться на разных стадиях развития, но даже в старости пламя сексуальности никогда не исчезает полностью, гасится только смертью.

Сексуальная энергия - это основная часть того, что побуждает нас вступать в интимные межличностные отношения, иногда несмотря на то, что с практической точки зрения такие отношения могут быть совершенно невозможными и в конечном итоге разочаровывающими.(См. Мой предыдущий пост.) Очень важно понимать, что, как и любая сильная эмоция, сексуальное влечение не всегда нужно действовать. Это то, с чем борются большинство женатых людей. Но это также верно и для одиноких людей, которые не состоят в серьезных отношениях. Сексуальное влечение - очень сложное явление, которое может быть как психологическим, так и биологическим. Некоторое сексуальное влечение может быть невротическим.

Но он также может рассказать нам кое-что важное о базовой, инстинктивной и примитивной части нас самих.То, что Фрейд называл «ид», Юнг называл «тенью», а Ролло Мэй - «даймоником». А также освещает то, что Юнг называл нашими анима или анимус , которые играют важную роль в сексуальном влечении. (См. Мой предыдущий пост.) Научиться распознавать, прислушиваться и уважать этот тварный сексуальный инстинкт может привести к раскрытию того, кто мы есть на самом деле. И кем нам нужно стать. Вот почему сексуальность всегда будет играть такую ​​важную роль в процессе психотерапии.

Сексуальность женщин и мужчин различается по своей сути.Большинство мужчин склонны рассматривать секс как нечто, от чего они никогда не могут насытиться, и стремятся на каком-то первичном уровне распространить свое семя как можно шире. Большинство женщин считают секс второстепенным по сравнению с интимностью, физической близостью и обязательствами. Мужчины склонны отделять секс от любви, эроса или романтики; в то время как женщины склонны приравнивать эти два понятия. Мужчины, как правило, менее разборчивы или моногамны в поисках сексуального удовлетворения; в то время как женщины, как правило, гораздо более избирательны и сосредоточены исключительно на одном конкретном сексуальном партнере за раз.Для большинства женщин секс в первую очередь связан с отношениями и деторождением, а потом - с удовольствием и сексуальным удовлетворением. У большинства мужчин эти приоритеты меняются местами.

Конечно, есть исключения из этих тенденций. И, в некоторых случаях, смена ролей. Но по большей части психологически значение сексуальности различно для мужчин и женщин, что является одним из основных источников трений и недопонимания между полами. (См. Мой предыдущий пост.)

Не менее важно признать, что первичная энергия, составляющая половое влечение, происходит от более общей жизненной силы или elan vital , которая одушевляет всех людей.Следовательно, сексуальную энергию можно выражать разными способами, включая художественное творчество, альтруистическое социальное поведение или духовное развитие. Но такая сублимация , как ее назвал Фрейд, не может полностью заменить или устранить сексуальный инстинкт. Если не получить адекватного выражения, это проявляется в навязчивых сексуальных фантазиях или других психических симптомах.

Секс может иногда заменять настоящую близость, служа способом дистанцироваться от других, а не процессом объединения, сближающим людей.В то же время секс можно использовать для того, чтобы не сталкиваться с самими собой и с экзистенциальными фактами жизни. Как и в случае с наркотиками, некоторые используют сексуальную активность, чтобы избавиться от чувства заниженной самооценки, беспокойства, одиночества (см. Мой предыдущий пост), бессмысленности, печали, горя, гнева или ярости. Или манипулировать другими и оказывать влияние на них и контролировать их.

Секс можно использовать как оружие, чтобы причинить боль людям, жестоко унизить их и с садистской точки зрения возмездие и возмездие за реальное или воображаемое пренебрежение.Такие злокачественные смеси секса и гнева достигают деструктивных крайностей в извращенных злодеяниях насильников и некоторых серийных убийц-психопатов. (См. Мой предыдущий пост.)

В западной культуре секс больше не является самым большим табу для психотерапевтов. Но это остается серьезной силой, с которой нужно считаться в лечении, особенно когда оно начинает выходить из себя, как в случае нимфомании, сатириаза, педофилии, мании, порнографии или сексуальной зависимости, а также супружеской неверности. (См. Мой предыдущий пост.) Или когда его отсутствие в чьей-то жизни становится источником разочарования, депрессии, беспокойства или гнева.Именно тогда мы вынуждены противостоять и обращаться к демонической природе человеческой сексуальности: ее способности овладевать личностью и вести нас к деструктивному поведению. Подобно сорнякам, проталкивающим мельчайшие трещины на асфальте, либидо, эрос или сексуальная энергия будут просачиваться в той или иной форме, если хронически отказывать в каком-либо здоровом выходе.

У некоторых людей это может проявляться в эротических отношениях с неодушевленными предметами, такими как, например, автомобили. В других случаях - для нечеловеческих сексуальных партнеров, таких как коровы, собаки, козы или лошади.В третьих, это превращается в психотические симптомы, такие как эротомания, бредовое расстройство, при котором пациент убежден, что другой человек, часто известный знаменитость, влюблен в него или в нее. А для некоторых диссоциированная сексуальность принимает форму фундаменталистских религиозных убеждений или духовных верований Нью Эйдж, или влечения и восприимчивости к опасным культам, которые используют сексуальность для проявления власти и контроля над своими членами. (См. Мой предыдущий пост.)

Наконец, существует тот факт, что человеческая сексуальность находится под сильным влиянием, к лучшему или худшему, как со стороны семьи и культуры, так и со стороны того, как знаменитые психосексуальные стадии развития Фрейда проходят в раннем детстве и подростковом возрасте.Перефразируя Фрейда, к тому времени, когда мы достигаем совершеннолетия, психологически в спальне всегда присутствует как минимум шесть человек. Из-за всего этого секс по-прежнему играет важную роль в современной психотерапии, хотя и не так, как во времена Фрейда.

В Вене Фрейда было широко распространено подавление и диссоциация сексуальных чувств и импульсов, которые, как обнаружил Фрейд, приводили к невротическим симптомам. Спустя столетие мы теперь живем в гораздо более сексуально раскрепощенном обществе, пройдя через «сексуальную революцию» в середине двадцатого века.Действительно, в настоящее время именно хроническое подавление гнева или ярости, а не сексуальность, на которую в конце концов обратил свое внимание более зрелый Фрейд, имеет тенденцию преобладать в клинической картине людей, страдающих различными психическими симптомами. (См. Мои предыдущие сообщения.)

Тем не менее, сексуальные проблемы, такие как эректильная дисфункция, аноргазмия, преждевременная эякуляция, генитально-тазовая боль / расстройство проникновения, подавленный сексуальный интерес, возбуждение или желание, компульсивная распущенность, сексуальная зависимость, избегание полового акта, страх перед противоположным полом, стыд или сексуальное торможение. довольно распространены сексуальные извращения, сексуальный садизм или мазохизм, а также симптомы, вторичные по отношению к сексуальному торможению или подавлению, такие как тревога, бессонница, хроническое мышечное напряжение, головные боли и многие другие.

Кажется, мы, люди, врожденные любовники, искатели естественных ощущений, безграничные источники эроса, по сути, сексуальные существа. Сексуальность - это часть нашей судьбы. То, что мы с ним делаем, решает нашу судьбу. В нашем постфрейдистском сексуальном освобождении нельзя недооценивать сверхъестественную силу секса, побуждающую нас искать сексуального удовлетворения. Эта сексуальная энергия может быть как творческой (и порождающей), так и разрушительной для себя и других. Это по определению иррационально, неудержимо и неумолимо.Секс и эрос как ключевой компонент daimonic требуют некоторого выражения. То, что мы делаем (или не делаем) с этой сексуальной энергией, определяет, кем и чем мы становимся, какие отношения мы создаем и как мы выражаем себя в мире. И, конечно же, коллективно, выживем ли мы как вид.

Лучшая защита от демонов и злых духов -

Сегодня во время чтения Евангелия Иисус проповедовал в синагоге, в то время как человек с нечистым духом слушал.Демоны внутри этого человека признали, что Иисус был сыном Божьим, и закричали: «Что тебе до нас, Иисус из Назарета? Вы пришли уничтожить нас? Я знаю, кто ты - Святой Божий! » Этот человек мог, по всей видимости, казаться таким же нормальным, как мы с вами, но под его внешним видом внутри него прятался демон.

Если вы поговорите с любым официальным экзорцистом в католической церкви, он скажет вам, что демоны обычно не овладевают человеком без его разрешения.Может иметь место непроизвольное одержание демонами, но в большинстве случаев человек что-то делает, чтобы ободрить злых духов.

Никто никогда не должен играть в настольные игры Уиджа, потому что это хорошо известный способ приглашения в мир демонов. Спросите об этом экзорциста. Это не просто игра. Карты Таро, медиумы, гадалки, вуду, Викка, колдовство, оккультизм или любое другое увлечение духовным миром или мертвыми могут привлекать и поощрять злых духов.

Даже если человек делал эти вещи ради развлечения, когда он был ребенком или подростком много лет назад, демон может прятаться внутри человека, оставаясь незамеченным в течение долгого времени.Вероятно, именно это произошло с человеком, у которого в синагоге был нечистый дух, которого Иисус исцелил в сегодняшнем Евангелии.

Бесы не выносят имени Иисуса, не говоря уже о том, чтобы быть в его присутствии. Фактически, имя Иисуса - эффективный способ справиться с присутствием демонов. Но лучший способ справиться с демоническими атаками или преследованием - это сам расти в святости.

Лучшая защита от демонов и злых духов - это регулярно посещать мессу, исповедоваться и вести регулярную, последовательную молитвенную жизнь.Мы получаем благодать от Иисуса через таинства и молитву, а также искренне живя по заповедям Бога.

Однако может случиться так, что чем ближе человек становится к Иисусу, тем больше его будут преследовать демоны или злые духи. Обычно это происходит в форме искушений. Демоны оценивают вас и ищут вашу самую слабую область, а затем, так сказать, бросаются на жонглера. Наживка, отвлечение и разделение - также некоторые из основных тактик, которые они используют, чтобы увести вас от Господа. Если вы когда-нибудь испытаете настоящую демоническую атаку или почувствуете, что вас преследует злой дух, лучший способ справиться с этим - пойти на исповедь, посетить дополнительные мессы, а затем провести немного больше времени, чем обычно, в молитве перед скиния или поклонение.

Иисус всегда сильнее демонов или даже самого сатаны. Они не переносят его присутствия, но их привлекает он, святыня и святые места, но они держатся на расстоянии, как в синагоге в сегодняшнем Евангелии. Само здание церкви не является преградой для демонов, но Евхаристия, святая вода и исповедь - они не могут прикоснуться к ним или приблизиться.

Святую воду и освященную соль можно использовать в домашних условиях, особенно в дверных проемах и окнах. Люди часто носят медаль Святого Бенедикта, которая тоже была благословлена, для дополнительной защиты от злых духов.Часто помогает молитва с четками, потому что, если вы помните, Богоматерь раздавила голову сатаны своими ногами. И, конечно, очень известна молитва Святого Михаила.

Есть много людей, которые считают, что демонические влияния - это просто форма психического заболевания. Иногда у человека действительно есть психическое заболевание. Иногда они действительно подвергаются преследованиям или одержимости бесом. А иногда и то, и другое. Это не ситуация "или или". Подлинное демоническое преследование может вызвать у человека такой стресс, что у него начнутся психические проблемы.У кого бы не было эмоциональных или психических проблем, если бы вас беспокоил настоящий демон?

Если вы, член семьи или друг когда-нибудь испытаете демоническую атаку, с которой вы не можете справиться, не стесняйтесь поговорить с экзорцистом в вашей епархии. Священники, которые служат экзорцистами, могут помочь разными способами, и именно для этого они здесь. На самом деле, многие протестанты и неверующие также контактируют с католическими экзорцистами. В нашем современном обществе есть много людей, которые перестали верить в существование дьявола, и поэтому немногие члены духовенства были обучены экзорцистам.Однако обычно в каждой епархии есть как минимум один официальный экзорцист.

Католическая церковь также активно увеличивает количество обученных экзорцистов, потому что влияние сатаны на наш мир в последние десятилетия возросло, особенно из-за роста сатанизма и вовлечения в оккультизм, особенно среди нашей молодежи. Поклонение сатане в настоящее время является официально признанной религией во многих странах мира. В США это религия, охраняемая законом.

Но мы не должны слишком беспокоиться о демонах и злых духах.Они ничего не могут сделать без разрешения Христа, что очень очевидно в сегодняшнем Евангелии.

Избавь нас от злых молитв и смысла

(2) Положительно: но избавь нас от зла; апо тоо понэроу - от лукавого, дьявола, искусителя; «храни нас, чтобы либо мы не подверглись нападению с его стороны, либо мы не были побеждены этими нападениями»: «Или от зла, греха, наихудшего из зол; зло, единственное зло; то зло, которое ненавидит Бог, и которым сатана искушает людей и с помощью которых уничтожает их.«Господи! Избавь нас от зла ​​мира, которое есть в мире похотью; от зла ​​всякого состояния в мире; от зла ​​смерти; от жала смерти, которое есть грех; избавь нас. от нас самих, от наших злых сердец: избавь нас от злых людей, чтобы они не были для нас ловушкой, а мы не стали их добычей ».

Источник: Комментарий Мэтью Генри ко всему тому V Библии (от Матфея к Иоанну)

Но избавь нас от лукавого] ​​APOTOUPONHROU, от лукавого.Сатана прямо назван ОПОНХРОС, нечестивым. Мф 13:19, 38, сравните с Мк 4:15; Лу 8:12. Этот эпитет Сатана происходит от ПОНОСА, труда, печали, несчастья, из-за тяжелая работа, которая встречается на пути греха, горе, которое сопровождает его совершение, и страдания, которые влекут за собой на нем, и на чем он заканчивается.

Сказано в МИШНА, Тит. Беракот, этот раввин Иуда был обычно молятся так: "Да будет тебе великим удовольствием избавить нас от дерзкие, и от наглости: от лукавого и от лукавого. шанс; от дурной привязанности, злого товарища и зла сосед: от сатаны-губителя, от сурового суда и жесткий противник."См. Лайтфут.

Доставьте нам] РУСАИХМАС- очень выразительный словесный разрыв наших цепей, и освободите наши банды, вырвите нас от зла, и его бедственная проблема.

Источник: Комментарий Адама Кларка к Библии

Избавь нас от лукавого. В оригинале в этом месте есть артикль - избавь нас от зла, то есть, как предполагалось, от лукавого или сатаны. В другом месте он именуется лукавым, Мф 13:19, 1 Иоанна 2:13, 14, 3:12.Избавь нас от его силы, его ловушек, его искусства, его соблазнов. Считается, что он великий родитель зла, и избавиться от него - значит быть в безопасности. Или это может означать избавить нас от различных бедствий и испытаний, которые преследуют нас, от тяжелых и угнетающих бедствий, которым мы постоянно подвержены.

Источник: Примечания Барнса к Новому Завету

Мэтью Генри (1662-1714) был английским священнослужителем-нонконформистом.Его комментарии к Священным Писаниям предназначены скорее как руководство к Библии, чем как критическое исследование.

Альберт Барнс (1798-1870) был пресвитерианским священником и американским богословом. Его «Заметки к Новому Завету» неоценимы, поскольку они помогают понять сложные отрывки Священного Писания. Барнс часто ссылается на греческий оригинал, чтобы раскрыть смысл текста.

Адам Кларк (1769 или с 62 по 1832 год) был методистским священником и библейским богословом.Его обширный комментарий к Новому Завету, насчитывающий около 6000 страниц, является одним из самых объемных произведений по Библии, когда-либо написанных одним человеком.

Почему Бог позволяет злым людям добиваться успеха?

Читатель написал важный вопрос:

«Это снова J…
Вопрос к вам: злые люди против хороших людей»
Почему кажется, что злые люди добиваются успеха в жизни? Они получают все, что хотят, продолжают получать благословения и живут дольше.

Почему кажется, что люди, которые пытаются жить хорошей (БОЖЕСТВЕННОЙ) жизнью, не могут найти передышку. . от зарплаты до зарплаты, стресса и т. д. »

Мой ответ получился довольно удачным, поэтому я подумал, что сделаю его постом:

Это болезненный вопрос, над которым многие размышляют, J. Ответ коренится в свободе воли. Многие поступки злых людей напрямую ведут к успеху; например, самым большим лжецом и манипулятором в отделе продаж обычно бывает главный продавец. Злой человек развивает умение видеть, как добиться оптимального результата в каждой ситуации, и готов предпринимать любые действия, чтобы получить наиболее желаемый результат… вот почему они так часто добиваются этого.

Эти люди НЕ получают благословений, они пожинают «награду» своего зла так же, как ребенок, обманывающий на экзамене, получает более высокий балл… это НЕ работа Бога, поскольку Он НИКОГДА не награждает зло.

Но почему Он вообще это допускает? Свободная воля. Мы все верим в свободу воли, мы хотим ее иметь, мы верим, что она должна быть у всех ... но мы, естественно, недовольны, когда злые люди используют ее для достижения «поверхностного успеха». Если бы Бог заблокировал любое злое поведение, у нас больше не было бы свободы воли; Более того, если все, что мы можем сделать, это быть хорошим, а не вопрос выбора, тогда мы не демонстрируем никакой действительной добродетели ... и Бог хочет, чтобы мы ВЫБИРАЛИ правильное поведение так же, как Он хочет, чтобы мы ВЫБИРАЛИ вера, а не быть «запрограммированной» на это.

И какова наша награда за эти выборы, а не за злые, которые так последовательно ведут к «поверхностному успеху»? У нас есть «истинный успех», единственное, что имеет значение; наша глубокая связь с Богом. Те злые люди, у которых есть денежный успех и успех в бизнесе, НЕ имеют такой связи с Богом. Для них это буквально невозможно, потому что Бог НЕ награждает зло никаким образом, включая эту самую драгоценную награду; Его близость.

Что бы вы предпочли; «Поверхностный успех», достигнутый злодеяниями, или близость к Богу? С этой точки зрения это не трудный выбор, не так ли?

Не завидуйте злым людям, добившимся «поверхностного успеха»; ПОЖАЛУЙСТА их, потому что они оставили единственное, что имеет значение, то, чем мы с вами благословлены в изобилии… близость к Господу.

Марка 8:36 (ESV)

36 Ибо какая польза человеку приобрести весь мир, а душе своей повредить?

PS: Большинству злых людей приходится бороться, чтобы оплачивать свои счета, как и всем остальным, мы просто не замечаем этого, потому что сосредоточены на успешных людях. Представьте, что вы разорены И не находитесь рядом с Богом !!

Редактировать 12-12: Я наткнулся на стих, который принадлежит сюда:

Псалом 37: 7 (NLT)

7 Будь еще в присутствии Господа,
и терпеливо ожидай, пока Он начнет действовать.
Не беспокойтесь о злых людях, которые процветают
, и не беспокойтесь об их нечестивых планах.

Edit 4-9-14: Вот еще один хороший стих:

Иов 8:20 (GNT)

20 Но Бог никогда не оставит верных
и никогда не поможет злым людям.

Edit 3-5-15: И еще пара хороших:

Притчи 23:17 (NIRV)

17 Не желай того, что есть у грешников.
Но всегда проявляйте большое уважение к Господу.

Притчи 24:19 (ГОЛОС)

19 Не волнуйтесь, когда злодеи остаются безнаказанными
, и не завидуйте, когда кажется, что нечестивые процветают.

Edit 7-18-17: и еще один:

Псалом 10: 13-14 (NLT)

13 Почему нечестивым сходит с рук презрение к Богу?
Они думают: «Бог никогда не призовет нас к ответу».
14 Но вы видите, какие неприятности и горе они причиняют.
Вы заметите это и накажете их.


Нравится Загрузка ...


Реальность снов - Фархат Хашми

Самиа Абдул Рахим

Мечты и видения

Отклонения в отношении снов: Некоторые люди недооценивают значение снов, полностью игнорируя их. Они называют их легендами и отвергают их просто потому, что они являются частью невидимого.В противоположном спектре есть люди, которые полностью полагаются на свои мечты до такой степени, что позволяют своим мечтам управлять своей жизнью. Они основывают свои жизненные решения и даже принимают законы и законы (например, то, что считается халяль и харам) в соответствии со своими мечтами. Например, одному мужчине приснилось, что его жена прелюбодействовала, и поэтому, когда он проснулся, он развелся с ней.

Реальность снов - согласно Корану и Сунне

Когда мы спим, наша душа частично покидает тело и возвращается обратно, когда мы просыпаемся.Следовательно, наш сон - это малая смерть и ежедневная подготовка нашей души к тому, чтобы вкусить большую смерть.

Виды снов:

Пророк (мир ему и благословение Аллаха) сказал:

«Сны бывают трех типов: сон от Аллаха, сон, который причиняет страдания и который исходит от Шайтана, и сон, который приходит из того, о чем человек думает, когда он бодрствует, и он видит его, когда он спит. ” (аль-Бухари, 6499; Муслим, 4200)

1. حديث النفس Self Talk: Большую часть времени мы мечтаем о том, что нас волнует, и о мыслях, которые занимают наш ум.Следовательно, эти сны являются просто отражением наших внутренних мыслей и забот и, следовательно, не требуют интерпретации.
2. الحلم من الشيطان - Сны от Шайтана: Не только наш враг, Шайтан, беспокоит нас, пока мы бодрствуем, но также и во сне!

Два способа, которыми шайтан может беспокоить нас во сне:

а. Страшные сны: эти тревожные сны исходят от Шайтана, так как его цель - напугать нас, потому что он знает, что наша сила и сила находятся в нашем сердце.Он хочет ослабить нашу веру или, по крайней мере, огорчить нас, чтобы мы перестали поклоняться Аллаху.

г. Придав во сне, что он / она совершает грех, или совершит какое-либо действие, противоречащее нашим убеждениям, например, появление обнаженным, совершение прелюбодеяния, употребление алкоголя и т. Д. наши мечты, если не в реальной жизни.

Что нам делать, если нам снятся дурные сны?

Доказательства из хадисов приведены ниже:

Абу Кутада сказал: Пророк (мир ему и благословение Аллаха) сказал:

«Хорошие сны исходят от Аллаха, а (плохие) сны исходят от Шайтана.Тот, кто видит что-то, что ему не нравится, пусть трижды плюнет влево и попросит убежища у Аллаха от шайтана, потому что это не повредит ему ». (Передано аль-Бухари, 6594, и Муслимом, 5862)

. Упомянутое здесь «плевание» - это мягкое, сухое плевание без выброса слюны.

Было передано от Джабира (да будет доволен им Аллах), что Пророк (да благословит его Аллах и приветствует) сказал:

«Если кто-либо из вас видит сон, который ему не нравится, позвольте ему трижды плюнуть влево и трижды искать убежища у Аллаха от шайтана и перевернуться с той стороны, на которой он спал.(Передал Муслим, 5864)

Абу Саид аль-Худри (да будет доволен им Аллах) сказал: Пророк (мир ему и благословение Аллаха) сказал:

«Если кто-либо из вас видит сон, который ему нравится, это от Аллаха, поэтому позвольте ему хвалить Аллаха за это и говорить об этом другим. Если он видит другой сон, который ему не нравится, то это от шайтана, поэтому пусть он ищет убежища у Аллаха от его зла и никому не упоминает о нем, потому что это не повредит ему ». (Передано аль-Бухари, 6584, и Муслимом, 5862).

В аль-Бухари, Бааб аль-Кайд фил-Манаам, от Абу Хурайры передается пятая вещь, а именно молитва. Формулировка сообщения такова: тот, кто видит во сне что-то не нравится, не должен никому об этом рассказывать; лучше ему встать и помолиться. Об этом сообщил имам Муслим в своем Сахихе в виде отчета Мусула.

Передается от Джабира, что бедуин пришел к Посланнику Аллаха (мир ему и благословение Аллаха) и сказал: «Мне приснилось, что мне отрубили голову, и я гнался за ней.Посланник Аллаха (мир ему и благословение Аллаха) упрекнул его и сказал: «Никому не рассказывай, как шайтан возится с тобой в твоих снах». (Передал Муслим, 2268)

Итак, когда нам снятся дурные сны, мы должны делать следующее:
1. Искать убежища у Аллаха от зла, показанного во сне.

Когда детям снятся кошмары, они обычно бегут к своим родителям в поисках утешения. В такие моменты мы, как родители, должны поощрять наших детей искать прибежища только у Аллаха, поскольку только Он может защитить их, а не мы.

2. Ищите убежища у Аллаха от зла ​​Шайтана. Произнесите истиадху: Аудху би'ллахи мин аш-шайтани'р-раджим
3. Плюнь (сухая слюна) влево три раза
4. Не следует никому рассказывать о сновидении (потому что это не поможет). причинить вам вред)
5. Должен поменять сторону
6. Рекомендуется совершить две молитвенные единицы, так как это будет действовать как двойная защита от злых ловушек шайтана.

Важно следовать сунне подготовки ко сну, поскольку это мощная защита от таких злых снов.

الرؤيا: Правдивые сны / Видения

«Истинные сны - одна из сорока шести частей пророчества». (аль-Бухари, 6472; Муслим, 4201)

Правдивость сновидения связана с искренностью сновидца. Самые правдивые сны снятся тем, кто наиболее правдив в речи. (Муслим, 4200)

Пророк (мир ему и благословение Аллаха) сказал:

«Это будет потому, что пророчество и его последствия будут так далекими во времени, поэтому верующим будет дана некоторая компенсация в виде снов, которые принесут им хорошие новости или помогут им быть терпеливыми и стойкими в своих делах. Вера.»(Аль-Бухари, 6499; Муслим, 4200)

Эти видения / правдивые сны крайне редки. За ними стоит смысл и может потребоваться интерпретация. Эти сны - радостная весть для верующих. Эти сны служат источником утешения для верующих, особенно во время испытаний и испытаний, для того, чтобы они оставались твердыми в своем вероисповедании. Они также могут быть предупреждением против зла или окном в некоторые события, которые произойдут в будущем. Однако новые законы и законы не могут быть выведены из таких мечтаний, поскольку наша жизнь завершена и была усовершенствована до смерти Пророка (да благословит его Аллах и приветствует).

Иногда даже неверующим снятся правдивые сны. Например, сон фараона о Мусе алайх ис-салам и сон царя во времена пророка Юсуфа алайх ис-салам. Однако оба этих правдивых сна на самом деле были средством чести и блага для верующих - Пророка Мусы и Юсуфа, а не для неверующих.

Два типа видений / правдивых снов:

1. واضح : Это очень ясные, правдивые сны. То есть в будущем произойдет то же, о чем вы мечтали.Это серьезное испытание от Аллаха, поскольку оно проверяет веру человека в то, что он действительно является истинным владельцем гаиба (невидимого). Только Аллах обладает знанием невидимого, и Он выбирает раскрыть часть этого знания тем, кого Он пожелает, в соответствии с Его бесконечной мудростью. Поэтому очень важно, чтобы человек из-за этих ясных видений / снов не отклонился, полагая, что эти сны происходят из-за их собственной праведности / способностей. Следовательно, это серьезное испытание для веры. Да защитит нас Аллах от таких отклонений, ameen
2. مرموز : Эти правдивые сны требуют толкования, поскольку они не являются ясными видениями. Однако толковать сны может только человек, у которого много илм и таква. Переводчик должен знать Коран и Сунну, быть умным и, что самое главное, иметь такву и избегать грехов.

Имам Малик упомянул, что толкование сна зависит не только от самого сна, но и от того, кому он приснился.

Добавить комментарий

Ваш адрес email не будет опубликован.